On 2017-09-21 23:45:21, user L Kushner wrote:
Any correlation or link between de novo variants at probands and the types of damage observed in the recent nature autism paper by Powell? Amazing what a contributing factor all of these are!
On 2017-09-21 23:45:21, user L Kushner wrote:
Any correlation or link between de novo variants at probands and the types of damage observed in the recent nature autism paper by Powell? Amazing what a contributing factor all of these are!
On 2017-12-19 23:04:26, user chloe goose wrote:
This is fascinating. Check it out. Clinically important sex differences in GBM biology revealed by analysis imaging, transcriptome and survival data https://t.co/z7PmAHDVr2
On 2021-10-25 18:16:45, user Peter Rogan wrote:
This article is in press in the International Journal of Radiation Biology. DOI: 10.1080/09553002.2021.1998709
On 2021-04-20 12:55:09, user Nelii cheps kips wrote:
Our recent work on bacterial attachment in high salt environment #brunlab #Caulobacterales #holdfast #polysaccharides
On 2018-05-16 12:54:35, user Michael Monaghan wrote:
When searching for primer and fragment-length information (I could not find either) I notice that (line 128) Sherwood and Presting (2007) is not in the References.
On 2023-11-08 20:29:54, user P. Bryant Chase wrote:
Molecular basis for the "Abbott effect"? Bud Abbott was thrilled to know it was still being investigated in the 1980's, and would surely be thrilled to see this work if he was still living.<br /> Abbott BC & Aubert XM. (1952). The force exerted by active striated muscle during and after change of length. J Physiol 117, 77-86.
On 2017-02-06 10:39:29, user B C M Ramisetty wrote:
Kindly note an error made by us regarding disk diffusion assay results in the text. Thanks to Dr. Xavier Charpentier for spotting the errors.
Until a correction is posted, kindly read it as "We observed that zone of inhibition of MG1655 with ciprofloxacin (10 ug) was 3 cm (averages) while that of ?10 strain was 3.6 cm (Figure 3B)."
"With ampicillin (10 ug), the zones of inhibition for MG1655 and ?10 strain were 2.1 and 2.45 cm, respectively."
"With nalidixic acid, the zones of inhibition for MG1655 and ?10 strain were 1.78 and 1.98 cm, respectively."
Thank you
On 2021-03-29 19:30:31, user PaleFlesh wrote:
Interesting study. However I am concerned with the usefullness of these findings since only two species were tested, which is too small of a number to definitively say these findings are universal. It would be interesting to see if these results could be replicated with trees, grains, or even algae.
On 2021-06-04 18:54:07, user jasonrasgon wrote:
We are aware of an error in this manuscript regarding the small RNA analysis, the data have been reanalyzed and a corrected version will be uploaded shortly.
On 2022-03-17 17:00:47, user Joram wrote:
This work is now published in Frontiers in Digital Health: https://doi.org/10.3389/fdg...
On 2017-04-10 01:52:09, user AdamMarblestone wrote:
-"Superficial layers of the medial entorhinal cortex replay independently of the hippocampus" http://science.sciencemag.o...
On 2017-10-21 19:00:44, user AdamMarblestone wrote:
-"Top-Down Feedback Controls Spatial Summation And Response Gain In Primate Visual Cortex" https://www.biorxiv.org/con...
On 2021-04-09 16:25:37, user Cyril Falentin wrote:
interesting paper, is it possible to get Supp Fig/Table and Supp Material 1 please ? can't find it.
On 2019-07-09 10:18:30, user Peter Manning wrote:
Hi Noemie- you're probably aware of it but we took a similar approach, but no SEM, in an old Ecotron experiment. Details here: https://www.sciencedirect.c...
On 2023-10-26 14:53:28, user Jordan Hamm wrote:
This paper is now published in PNAS. https://doi.org/10.1073/pna...
On 2020-06-25 16:59:55, user Jitin Singla wrote:
Please refer latest version
On 2022-05-13 17:10:25, user Prof. T. K. Wood wrote:
May wish to cite the literature relevant to MqsR/MqsA since we discovered it in biofilms, characterized it as a TA system, and got the structure for the toxin, antitoxin, and antitoxin binding DNA (all not cited here). Moreover, we linked it to resistance to bile acid in E. coli.
On 2022-09-30 22:29:03, user MIT Microbiome Club wrote:
It is know that the effect of a drug, and therefore perhaps a bacteria, can be non-linear with concentration, and that dose-additivity (Bliss) predicts drug combinations better than effect-additivity (DOI: 10.1038/s41564-018-0252-1). How might this impact the results? Of course, it can hard to half the concentration of the bacteria in the setup to create the Bliss model (although maybe something with lower glucose might help?) Might the fastest grower in each pair/trio reach the highest concentration, limit the growth of other species, and therefore provide an effect quite similar to itself in isolation? How would a "fastest grower" model compare to a "strongest" model? The authors note that growth rate did not correlate with effect size for "some" focal species, but might such a model work for the remaining focal species?
On 2023-07-20 09:13:24, user Dmitrii Kriukov wrote:
This is a great paper I found so long! Thank you for your work! You express many thoughs I had and even more.
Minor comments to your work:
Fig 3: "Black indicates observed variance; grey unobserved". - there is no grey entities, only black circles.
Fig 10: "MRL" in the legend
I would be excited to see also the experiment with KD method versus real data and its comparison to different MLRs.
On 2016-12-01 10:47:51, user Torbjørn Ergon wrote:
This paper has now been published as Open Access in Journal of Evolutionary Biology. Download at https://www.researchgate.ne...
On 2022-10-02 17:56:40, user Carrie Partch wrote:
The labs of Seth Rubin and Carrie Partch at UCSC jointly reviewed this preprint. This manuscript examines how the two transactivation domains (TADs) of ?-catenin interact with several domains of CBP/p300 to potentially control transcriptional activation. A combination of biochemistry, NMR, and ITC studies narrow down several binding sites for TAZ1 and TAZ2 domains. Overall, the manuscript is well organized and provides new details on these interactions that may play a role in ?-catenin function. We have some suggestions that might enhance the clarity of the work below. Thanks for an enjoyable read!<br /> Figure 1: <br /> • The schematics do not depict consistent widths/domain lengths and CBP/p300 is missing some domains, including one implicated in ?-catenin binding (Emami et al. 2004, PNAS).<br /> • It would be helpful if your schematic also illustrated all of the constructs used in the study and these names were used consistently.<br /> • If space allows, a simplified diagram of the pathway described in the text could be helpful.
Figure 2:<br /> • It would be helpful to add dashed line for predicted secondary structure cut-off at 0.3 in panel B.<br /> • It would enhance the rigor of the work to show expression levels for the constructs used in panel C.
Figure 3:<br /> • Labeling the MW markers, light and heavy IgG chains, and proteins (does the 666-781 fragment overlap with the light chain?) in panel A, along with the input, would make this figure easier to read.<br /> • The results of the pulldown seem pretty straightforward so quantification from n = 2 experiments seems unnecessary. If you do so, please define what ‘relative’ means in the quantification and make sure that your statistical methodologies are appropriate for this low n.
Figure 4:<br /> • There is some concern that the ITC data might be overfit to a two-site binding model without more information on the fits. Additional rationale or evidence that justifies use of the two-site model would also be welcome.
Figures 5 & 7:<br /> • It might be easier to interpret the binding interface if you used surface representation for the TAZ domains instead of ribbon.
Figure 8:<br /> • It was a bit confusing to show an analysis of the NMR data from the construct used in Fig. S3 in panel A, but then use data in panels B – E from a larger construct. We struggled a bit throughout the manuscript to match domain names and fragments (see Fig. 1 comment above) with the data.<br /> • It could be helpful to conclude with a cartoon or schematic that illustrates what was learned here.
Other:<br /> • Discussion text mentions a possible role for phosphorylation of serines; if citations for this exist, please add them or perhaps broaden this to a possible role for PTMs in general.<br /> • Consistent labeling of ITC data throughout the paper would help clarify which fragments of b-catenin were used in each experiment.
On 2017-03-02 23:39:01, user Stephen Williams wrote:
FYI the supplemental data is in a .tar ball not .txt.
On 2023-11-24 14:29:41, user eldad-a wrote:
Afik, E., Liu, T.J.B. <br /> & Meyerowitz, E.M. Macroscopic waves, biological clocks and <br /> morphogenesis driven by light in a giant unicellular green alga.<br /> Nat Commun 14, 6204 (2023). https://doi.org/10.1038/s41467-023-41813-6
On 2018-08-07 08:16:05, user matthewcobb wrote:
As an alumnus (1992, I think - the year Seymour Benzer came on the course as a student...), I thought this was a really interesting article. However, I think it could be strengthened quite a bit by being more critical/taking the long view and exploring some of the following questions:
How has *what* is taught changed over time, and *how* it is taught?
In retrospect, did the course get obsessed with certain techniques that turned out to be dead ends? How were the topics chosen? A summary of the topics taught in a table, together with some analysis, even hand-wavy, would be really useful.
How did the course contribute directly to the spreading of techniques, or did it only teach things that were well-established?
You describe how students are recruited, but what about the staff? You say where they are from, but what kind of 'social network' underpins staff selection? Has this changed over time? Why (not)?
CSHL has a tradition of highly influential summer courses (the Phage course in the 50s and 60s would be the obvious example). How does the fly course compare to this? Has it been as influential (probably not, although maybe in the early years), and if so how do you measure this?
Finally, I think you need to be a bit more critical about the claims for the role of the course in future careers. Understandably, you don't have a proper control group – as you explain, the students you recruit are generally the best/most motivated (I exclude myself from this ), so you can't compare their success with the overall grad school figures. You can make the comparison, but your suggestion that the course has 'a dramatic impact on trainee outcomes' isn't supported by it.
Good luck with the publication of this!
Matthew Cobb
On 2019-09-11 15:31:45, user Vesta Bahrami wrote:
Hi,
A question! What about those Zorastrians who converted to Islam recently? I also have a comment: I am from Iran and I have been told my family (from my mother side) were practicing this religion until 1900. My mom is from a place close to Hamedan in central Iran. My grandpa told us that they were from a big family (Bahrami) and they practiced persian religion not Islam until recent. They do not practice Islam now anyway, but are registered as muslims. They are from Persian_A group (I guess) since they live in that area. And also another comment. In Iran, in old days, people mixed mostly with local people who they shared similar genes with. Do u know if it is the same in other groups that Iranian Zartoshtis? And I know some Bahai people are mixed with zoroastrians in Iran.
On 2020-01-27 01:34:19, user Petting My Dog wrote:
So according to the formula a 1 year old dog would be aged to 31 Years right?
On 2022-10-24 23:44:43, user CDSL JHSPH wrote:
Thank you for giving us the opportunity to review your preprint article! I enjoyed reading the article and it was fun to learn a little more about whale songs and their potential influences. Understanding how vocal learning and conformity is especially important as the noise environment continues changing in the ocean. Overall, the article had a lot of information that supported how much fin whales depend on vocal learning and conformity.
I felt that your abstract and introduction requires additional information to understand the paper. There was a clear definition for vocal learning, but conformity and what a singing season is was not well defined. Additional information on fin whales would have also been nice to better understand their behavior not in the context of song. I liked how you included other examples of species to gain a better understanding and it also helped show that this study could potentially translate to those species as well. It was clear what questions you were trying to answer with your study, and you defined your results clearly without going too deep into it.
For the most part your methods and results were clear to understand even for someone who has no background in what was studied! In Figure 2, I thought that I had was to potentially add a comparison in Panel C to the 1998/1999 season. It would be interesting to see the change that occurred in all the locations in the ONA region instead of just seeing the one shown in Panel B. Figure 3 was clear to understand and it supported most of the claims that were made in the introduction. I thought it was very cool to see how many ways these figures could be interpreted. An additional suggestion that I have is for Figure 4, I felt like the figure caption was bare and was missing some information to make it easier to understand and there was not much detail into what this figure was supporting so I had to make my own inferences into what was being shown there. Additionally, frequency of note was spoken throughout the article so the frequency on the y-axis was confusing so potentially changing or clearly defining that axis title would be beneficial.
The discussion section in your paper went into a lot of detail and at times felt like too much. The discussion of the results that you obtained were lost in a lot of the extra information that was in it and at times were confusing since it felt like it was jumping around too much. At times it felt like I was reading a review article on animal songs instead of results from a study, but some of this information may be beneficial to have in the introduction section instead. Overall, I thoroughly enjoyed getting to understand whale songs a little bit better and the results that came out of your work are very interesting and hopefully this can form a basis for future studies in other animals that use song.
On 2025-03-17 14:47:47, user Gabriele Scheler wrote:
It looks like you omitted this paper https://pubmed.ncbi.nlm.nih.gov/29071065/ and the earlier paper by Koulakov etal., which showed that Hebbian learning alone - for instance in a homeostatic setting - is sufficient to result in lognormal distributions of synaptic strengths, also intrinsic strengths and spike rates. This was first discovered by SchelerSchumann2006, taken up by Hromadkaetal2008 and then explained by Scheler2017. With the exception of Buzsaki, the whole discussion is missing.
On 2021-02-05 18:43:15, user Morgan wrote:
Nice work from the Stavrou lab! I do have a question about the statement that the MARCH proteins addressed in this study target viral glycoproteins for degradation. Do you think MARCH proteins could be targeting various viral GPs through different mechanisms? For example, I noticed levels of cell lysate EBOV-GP2 was assessed in the presence of MARCH1/2/8, but did you assess the level of EBOV-GP0? Other studies on MARCH antiviral activity suggest EBOV-GP sequestration to the golgi and inhibiting processing of GP0 to GP1/2. How might you explain or reconcile conflicting reports? Also curious, do you have localization data or inhibitor experiments performed not only with MLV but also HIV-1, EBOV-GP, IAV, and the other viral GPs assessed in this study? I think those data would be interesting to see! Thanks for your time and efforts!
On 2020-05-18 13:31:12, user Jessica C Kissinger wrote:
My research group and collaborators are pleased to share our research on the complex & novel mitochondrial genome of Toxoplasma and related parasites with the larger parasite and evolution communities @WiParasitology @ISEPprotists @CTEGD. We welcome your feedback.
On 2019-04-01 07:40:24, user Jubin wrote:
The authors have missed to mention/compare a related tool called SVAMP that has already got a nice and user-friendly GUI: https://github.com/raeece/s...
The original paper for the same can be found here: https://www.ncbi.nlm.nih.go...
On 2019-03-31 00:38:04, user Gokul Rajan wrote:
Nice work. :) It's really interesting that the microbes were necessary for this learning task; but isn't it an overstatement to call them sufficient for cognition?
On 2021-03-18 21:47:49, user Raghu Parthasarathy wrote:
This looks useful, and I'm glad you found my work valuable! I strongly feel, though, that science doesn't need more acronyms (see e.g. here: https://elifesciences.org/a... "https://elifesciences.org/articles/60080)"), and simply combining my radial symmetry localization with FISH doesn't warrant a new term.
Also, by the way, I generalized my algorithm to 3D many years ago, but never formally published it (https://pages.uoregon.edu/r... "https://pages.uoregon.edu/raghu/Particle_tracking_files/radial_symmetry_3D.html)"). Other people also made a 3D version, as noted in the link above. If you had contacted me, I'd have happily told you about this and saved you some work.
On 2021-03-08 14:39:24, user @DrySci wrote:
Nice article @benjraphael et al... are there possibilities to apply in targeted sequencing data ?
On 2021-11-05 16:17:02, user Alizée Malnoë wrote:
The manuscript by Seydoux et al. investigates the role of proton potassium antiporter KEA3 in diatoms. The authors first demonstrated the pH dependence on photoprotection, specifically non photochemical quenching (NPQ) and showed that NPQ can be induced in the dark by acidic pH. They found that KEA3 modulates NPQ by impacting the proton motive force (PMF); indeed generated kea3 mutants showed increased partitioning into deltapH. Importantly they showed that diatom KEA3 in contrast to plant KEA3 possesses an EF hand motif which can bind Ca2+ and proposed that it controls KEA3 activity. The role of KEA3 and pH in affecting the NPQ response has been previously shown in other photosynthetic organisms however the novelty of this study lies in the demonstration that NPQ can be induced in the dark by acidic pH and the proposed role of Ca2+ in regulating KEA3 function.
Major comments<br /> - Page 5, you state that pH-induced quenching in the dark was accompanied by the conversion of DD into DT. Please provide de-epoxidation state (DES) at t15 time (Fig. 1B) to substantiate this statement. Starting DES would also be informative to ensure there was no retention of DT/zeaxanthin in the dark. <br /> - Also to ensure there is no sustained NPQ (and/or damage or disconnected antenna) at t0, please provide Fo and Fm levels for all NPQ kinetics experiments. Assessing PSII accumulation by D1 immunoblot could be done to ensure PSII damage does not occur.<br /> - In Fig. 2F, it is not clear which data points represent HL or ML treatment as well as which ones come from light or dark period. Please indicate them in different colors or symbols. Also clarify whether you have averaged data from the kea3 mutant alleles.<br /> - To confirm that lack of complementation by deltaEF is not due to mislocalization, please show whether deltaEF accumulates at the thylakoid membrane.
Minor comments<br /> - Page 3, Introduction, specify qE after NPQ response; PSBS should be written PsbS<br /> - Page 4, DD-dependent NPQ should be DT-dependent<br /> - Page 4, we suggest changing “crucial” to “Given the unknown role” if pH-dependence of NPQ in diatoms hasn’t been fully established before<br /> - Page 8, KEA3 most likely homolog, were there other homologs than the two shown in Fig. S5? also discuss conservation of other ion channels (is Phatr J11843 thylakoid-localised?) and if they could compensate for the absence of KEA3 in KO mutant (by being upregulated for instance).<br /> - Fig2B, comment on the band at ~80kDa in OE, is that from cleavage of GFP?<br /> - Fig2G, shouldn’t you expect a lower dpH in the OE? Please comment.<br /> - Page 13, for the statement that only dpH can modulate NPQ, we would suggest to tone down or specify that this is the assumption made here as it could be that dpsi modulates NPQ but has yet to be shown!<br /> - Most of the protein analyses were performed loading samples based on protein content, when possible please provide proof that chlorophyll levels are comparable between the genotypes (at least for the native gels)<br /> - Abstract, extra ‘of’ between capacity and via; page 23, extra ‘being’ between likely and less important<br /> - Define acronyms when used for the first time<br /> - There is a lot of ‘peculiar’ in the text ;-)<br /> - Fig. 2D, star symbol instead of square symbol, check consistency of symbols
Pushan Bag, Pierrick Bru (Umeå University) - not prompted by a journal; this review was written within a preprint journal club with input from group discussion including Alizée Malnoë, Maria Paola Puggioni, Jingfang Hao, Jack Forsman, Wolfgang Schröder, Emma Cocco, Jianli Duan.
On 2022-09-26 12:05:30, user Miha Moškon wrote:
The final version of this paper has been published at https://doi.org/10.1016/j.biosystems.2022.104778
On 2017-07-12 17:39:25, user guillemaud wrote:
PREPRINT PEER REVIEWED AND RECOMMENDED by PCI EVOL BIOL
This preprint by Clemente has been peer-reviewed by Michael D Greenfield and Joël Meunier and recommended by Vincent Calcagno for Peer Community in Evolutionary Biology. Peer-reviews, decisions, author's replies and the recommendation can be found here: https://evolbiol.peercommun...
On 2016-07-31 09:08:38, user Steven Wilson wrote:
This manuscript has been revised and accepted after peer-review, and should be available for open access reading in about a month!
On 2020-07-18 08:25:51, user Önder Kartal wrote:
Our paper has now been published by Genome Biology, <br /> see https://genomebiology.biome...
On 2023-09-26 21:25:26, user Victor M Faundez wrote:
Paper is now in press at Human Molecular Genetics<br /> https://doi.org/10.1093/hmg...
On 2018-12-11 22:42:03, user Andrew Leifer wrote:
Thank you for reading our manuscript closely and for sharing your comments with the community. We welcome a robust scientific discussion about our findings. In fact, this is one of the primary reasons why we post to the bioRxiv. Your group, in particular, has done pioneering work in this area and we value your thoughts. Below we provide a brief response to your note, highlight areas where we disagree, and discuss specific analyses to support our claims.
Extrapolating from your pioneering work, we had expected to see a dominant behavior signal in the first three PCs of neural activity, but we did not find such a signal. You express concern that perhaps noise may be present to such an extent during movement that it precludes drawing any conclusions from our PCA analysis. We do not think that is the case. Nonetheless, it is worth imagining what such noise would have to look like for it to both invalidate our PCA analysis yet simultaneously preserve our ability to successfully predict behavior. To be consistent with our measurements, such noise would have to have the following properties: 1) Be comprised of at least three independent orthogonal components that are the most dominant features in the recording. 2) Be distributed across many neurons (because otherwise these signals would not dominate in PCA, which involves z-scoring each neuron's signal). 3) Not overpower a signal that we observe in the first three PCs that is slightly predictive of the animal's velocity in GCaMP worms but absent in GFP control worms (Fig 2G) and 4) still preserve our ability to predict velocity and turning from the activity of a subset of neurons on held out data. While we cannot rule out noise with such unique properties, we think a much simpler explanation is that the first three PCs are not dominated by noise. We therefore merely conclude that the first three modes lack predominant behavior signals. In retrospect, it may not be surprising that moving worms have other signals dominating their neural dynamics. These could, for example, be related to sensory signals or to internal states.
https://uploads.disquscdn.c...
https://uploads.disquscdn.c...
We are aware that estimating neural IDs is extremely challenging. We have tried to be very transparent in our estimates. Table S2 and the supplementary methods give details. We are also happy to answer any specific questions you might have.
Sparse models have been successfully used before in neuroscience (Pillow et al., 2008; Tankus et al., 2012). We are aware of potential concerns with fitting sparse models. We mitigate them by 1) using elastic net which is suitable for highly collinear datasets such as ours, 2) using cross-validation to evaluate the robustness of our fits (Roberts et al., 2017), and 3) assessing model performance on held-out data, which we note is a higher standard than typically used for linear regression in the field. <br /> In fact, reference (Wu et al., 2007) that you mention in your note claims that LASSO performs best for datasets like ours where the variables have correlations, and we note that our elasticnet model incorporates the LASSO penalty.
Thank you for finding the typo in Fig 2D. We will fix it in future versions of the manuscript.
We appreciate your comments as they help us to strengthen the manuscript and anticipate reviewer comments.
Sincerely,<br /> Monika Scholz and Andrew Leifer
REFERENCES
Kato, S., Kaplan, H.S., Schrödel, T., Skora, S., Lindsay, T.H., Yemini, E., Lockery, S., and Zimmer, M. (2015). Global brain dynamics embed the motor command sequence of Caenorhabditis elegans. Cell 163, 656–669.
Pillow, J.W., Shlens, J., Paninski, L., Sher, A., Litke, A.M., Chichilnisky, E.J., and Simoncelli, E.P. (2008). Spatio-temporal correlations and visual signalling in a complete neuronal population. Nature 454, 995–999.
Roberts, D.R., Bahn, V., Ciuti, S., Boyce, M.S., Elith, J., Guillera-Arroita, G., Hauenstein, S., Lahoz-Monfort, J.J., Schröder, B., Thuiller, W., et al. (2017). Cross-validation strategies for data with temporal, spatial, hierarchical, or phylogenetic structure. Ecography 40, 913–929.
Scholz, M., Linder, A.N., Randi, F., Sharma, A.K., Yu, X., Shaevitz, J.W., and Leifer, A. (2018). Predicting natural behavior from whole-brain neural dynamics. BioRxiv 445643.
Tankus, A., Fried, I., and Shoham, S. (2012). Sparse decoding of multiple spike trains for brain–machine interfaces. J. Neural Eng. 9, 054001.
Wu, Y., Boos, D.D., and Stefanski, L.A. (2007). Controlling Variable Selection by the Addition of Pseudovariables. Journal of the American Statistical Association 102, 235–243.
On 2024-03-27 20:38:47, user Chris Buck wrote:
I've posted some further thoughts about this manuscript on my Substack page:<br /> https://open.substack.com/p...
On 2021-09-14 14:35:27, user Donald R. Forsdyke wrote:
The final peer-reviewed version of this paper may be found in Computational Biology and Chemistry 94:107570
On 2014-05-15 07:55:24, user Daniel Klevebring wrote:
Very nice work.
For some reason, I can't see the figures in the PDF of the main paper. The suppl figs show nicely, but only white boxes in the main PDF. Any idea why that is?
thanks
On 2017-04-20 18:45:48, user Loren Hauser wrote:
Interesting, but unfortunately this doesn't tell me if the variation is planned or just due to mis<br /> takes by the splicing system in cells. You really need to combine this with proteomic measurements that tell which splice variants are actually translated and inserted into the membrane.
On 2019-05-01 16:07:38, user Bert wrote:
Interesting, but there is no evidence yet that there is actually a TonB-dependent (outer membrane) transporter that imports these compounds.
On 2023-07-06 12:26:49, user Felix Hernandez wrote:
This MS has been published in International Journal of Molecular Sciences - MDPI
On 2018-05-09 17:37:56, user Uri David Akavia wrote:
Congratulations Dylan!<br /> Is the source code going to be available at some point?
On 2021-10-12 13:47:56, user Luisa Hugerth wrote:
The github link in the abstract leads to a 404 Page Not Found error. Maybe the repository is mistakenly marked as private?
On 2022-06-24 01:15:41, user Jichen Bao wrote:
The manuscript has been accepted by ACS synthetic biology. https://pubs.acs.org/doi/10...
On 2022-11-22 11:33:47, user Deepali Pal wrote:
Part of this study has been pre-print as below:<br /> https://www.cell.com/cell-r...
On 2020-07-22 19:33:46, user Richard Sanchez wrote:
interesting work from Ferdosi et al. It beautifully illustrates PTEN as a<br /> novel marker for neddylation inhibition as well as further exemplifying<br /> the integration of multi-omic data.
On 2020-06-13 03:31:18, user Ray wrote:
Introduce both mutations into the virus and test if one can outcompete the other in cell culture. If yes repeat with model animals. Only then you can say that. Everything else is jumping on the COVID-19 train to get an easy publication. But I guess that's the only way to get money for your lab atm. Science has become a commercial product that is being milked by mass media and journals. The more scary the better it sells. This doesn't help. This just makes things worse.
On 2018-07-31 11:29:06, user H. Etchevers wrote:
Accepted in a special issue of the journal "genesis" (Wiley) for the 150th anniversary of the neural crest, to appear at http://dx.doi.org/10.1002/d...
On 2018-10-02 19:55:41, user BU_Fall_BI598_G3 wrote:
Reinhard et al. performed transsynaptic tracing of retinal ganglion cells (RGCs) from targets in the superior colliculus (SC) projecting to either the lateral pulvinar (LP) or the parabigeminal nucleus (PBg), in order to determine how visual features are routed to the two areas. Analysis of dendritic morphology showed that retinal inputs to the parabigeminal and pulvinar circuits differ in size and stratification, and labelled RGCs were also characterized by their molecular identity. Morphological and molecular data was then used to identify twelve clusters of RGCs; each cluster contained cells of similar dendritic profile and molecular makeup. The LP and PBg receive input from distinct clusters, and the authors argue that each cluster contains a single cell type, which may encode a unique feature of the visual environment. They show that the SC demonstrates a relatively high degree of regularity in its guidance of inputs to various targets.
Overall, this study offers an in-depth look at the pulvinar and parabigeminal pathways. Reinhard et al. were successful in identifying which RGCs provide input to the LP and/or PBg, and the identifications made in this paper are helpful in indicating what type of input each nuclei is receiving. Another key strength of these experiments is the ability to express GCaMP in specific RGCs based on their downstream projection pathways. Such a technique is very useful for future experiments to precisely characterize ganglion cell response to a visual stimulus. Finally, Table 1 offers a nicely detailed summary of the structural and functional information on the pulvinar and parabigeminal circuits gathered in this study as well as in other studies. This summary allows clear understanding of the pathways and hints at possible future studies.
While we appreciate this manuscript’s strengths, we identified a few areas of major critiques, addressed below.<br /> Some important controls to verify the validity of the experimental setup are missing. Although using Cre-inducible viral cargo in injections to the lateral pulvinar is a good experimental design, it is not proven that the floxed TVA-G-mCherry is expressed in pulvinar-projecting neurons only. To verify this specific expression pattern, in a NSTR1-GN209-Cre brain injected with HSV-flox-TVA-G-mCherry and stained for pulvinar-projecting neurons, all fluorescent cells should be double-labelled. Additionally, does the experimental technique label cells in the superior colliculus that project to both the lateral pulvinar and parabigeminal nucleus? Such cells would take away from the claim that visual information is, for the most part, routed separately to these two areas. To test this possibility, we suggest injecting HSV-GFP into the pulvinar and HSV-mCherry into the parageminal nucleus and subsequently studying the superior colliculus for any double-labelled yellow cells. Also, rabies virus is known to destroy cells about ten days after infection. Therefore, significant variations in cell morphology created by the rabies virus could be present in the later stages of infection . We would like the authors to show that at the time of retinal extraction, the RGCs are still healthy and not yet negatively impacted by the rabies virus. Finally, though it is important to be able to extract out individual dendritic trees for analysis, does choosing cells only with non-overlapped dendrites create bias in the morphological or molecular identities of the chosen cells?<br /> Throughout the paper, techniques and ideas could be explained more clearly. Confusing wording and sentence structure make the paper difficult to follow at times (for example, the sentences starting on lines 112, 115, and 205). Additionally, the authors’ experimental setup is not entirely clear from the first few paragraphs of the paper. More detail about the viruses used, their cargo, and the expected expression patterns would be helpful for the reader to understand the overview of the experiment. A cartoon or an improved diagram of injection locations and expected labelling of the cells within the circuits could help with clarity. In other areas of the paper, the authors’ rationale for experiments is ambiguous. For example, with the description currently given in the text (lines 145-158), Figure 5 is very confusing. A more complete explanation of the rationale behind clustering the cells and brief descriptions of the three validation indices would make Figure 5 significantly more clear and highlight its importance for the rest of the paper. Another area that could benefit from further explanation is the comparison of 7 clusters to groups of PV cells in Figure 7. I.e., why were only 7 clusters shown and why were PV cells used for the comparison?<br /> The content and style of various figures made assessing the experimental design and results challenging. Small image/diagram size and low contrast was a recurring problem in several figures. For example, confirming injection specificity in Figures 1B and 1F is difficult simply due to image size. However, specific verification that fluorescent cells shown are truly in either the parabigeminal (1B) or pulvinar nucleus (1F) should be included also. Additional images verifying the placement of the EnvA-RV-GCamp6 superior colliculus injection would also be beneficial for readers. Image size and contrast was also an issue in Figures 1C,1G, 4A, and 4D. Low image magnification in figures 3C, 3G, and 4B made it difficult to see the colocalization of fluorescent labels. Similarly, to identify the lack of colocalization, Figures 4E and 4F should have been merged. Figure 2B should show percentages of cells rather than number, to provide more context for the data. Figure 1A and 1E depicting injection sites were confusing due to the color scheme chosen to represent HSV-TVA-G-mCherry and GCamp6. While we appreciated that two different colors were used to represent HSV-TVA-G-mCherry for the pulvinar injection (green) versus the floxed version for the parabigeminal injection (orange), this became confusing because the word GCamp is highlighted in green in the figure. Additionally, Figure 4 could be further improved if a quantification of CART+ cells was included, similar to what was done in Figure 3 for SMI32+ cells.
Additionally, there were a few minor weaknesses that, if addressed, could improve the quality of the paper. <br /> 1. The RGC clusters and their projections to the pulvinar and/or parabigeminal circuits identified in these experiments are useful in identifying the clustering of cells and subsequent circuitry implicated in routing visual inputs through the superior colliculus. However, an important distinction should be made between the identification of clusters versus cell types, as it cannot be necessarily concluded that cluster is equivalent to cell type. The 12 clusters identified in these experiments are referred to as putative cell types (line 161), and we do not believe the data presented in this paper is enough to make such a claim. Clusters may very well contain different types of cells that had similar morphology resulting in them being grouped into the same cluster, and the molecular data is not robust enough to validate these clusters as cell types. Moreover, the 3 clusters that were found to project input into both the pulvinar and parabigeminal circuits were referred to as ‘3 visual features’ (line 243). While separate clusters may represent distinct features of the visual space, this conclusion cannot be inferred from the data in this paper. <br /> 2. For both Figures 5 and 6, adding a color legend that identifies each cluster by the descriptive name given to it in the text (and Table 1) would help clarify the figures for readers. <br /> 3. In Figure 5, a 3D plot of the clusters could be added in the supplement for better visualization of the clusters along all three axes. <br /> 4. Use of PV-Cre mice as wild type mice is not discussed or validated.
On 2015-12-04 13:27:31, user Hiren Ghosh wrote:
Have any one tested this algorith with his/her own dataset ???
On 2023-11-10 16:44:10, user KJ Benjamin wrote:
Interesting approach, but I'm confused why the authors would model population instead of genetic ancestry? The authors use ADMIXTURE to show a great degree of mixed ancestry, but do not examine the effect of genetic ancestry, but "population grouping". This would be extremely influenced by environmental factors that are differences across and within continental groups.
On 2016-05-13 00:51:27, user Donald R. Forsdyke wrote:
Please note that the case has been made that "BDM" should be "DM". See Heredity (2011) 106, 202 (http://post.queensu.ca/~for... ).
On 2025-07-15 22:07:24, user Åshild Telle wrote:
Links to movies (Supplementary Material):
https://www.dropbox.com/scl/fi/pa00vq7h29jlptegmkmp3/Patient1.m4v?rlkey=8xj6oula1ys68vdpzprhmlu61&dl=0 <br /> https://www.dropbox.com/scl/fi/7daf5rwkbh907lhxq03yk/Patient2.m4v?rlkey=8td1vwxhl4f70w2151owcmful&dl=0 <br /> https://www.dropbox.com/scl/fi/m0rd44brd5mhxllcm9cra/Patient3.m4v?rlkey=6t6er8qicg1t5pfgpuhnk05es&dl=0
On 2019-03-27 19:49:57, user Andrew Johnson wrote:
Nice work. A few minor comments: <br /> 1) the 1st report of IQGAP2 rare variant association with MPV was Ref. 49 - comment is that this was an Exome chip study rather than GWAS<br /> 2) rare variants in KALRN first reached genome-wide significance for MPV in Gieger et al., 2011 PMID 22139419 (not currently cited here), subsequently replicated in Eicher et al. Ref 49 and then Astle et al. Ref 29
On 2020-05-27 15:45:40, user OxImmuno Literature Initiative wrote:
On 2023-03-29 14:06:54, user Sarah Chellappa wrote:
Thanks for sharing these important insights. It is unfortunately not surprising that race/ethnicity and socioeconomic status are not frequently reported. Most sleep and circadian studies come from study samples comprised of individuals who are white, middle-class and from high-income countries. Hence, there is a historic imbalance that perpetuates until today. One of the perks of addressing this issue is that it will help foster more research into the socioeconomic determinants of health.
On 2021-01-05 00:58:07, user Charles Warden wrote:
Hi,
Thank you for posting this pre-print.
I see that this pre-print has both supplementary material and a link to code:
https://www.biorxiv.org/con...
https://github.com/OSU-BMBL...
However, the section for "Supplementary Materials" says "Supplementary Data are available at Science Advance online".
Is this intentional (perhaps part of an automatic submission from a journal?), or should the section say something else?
Best Wishes,<br /> Charles
On 2015-09-03 07:53:42, user Pierre Boursot wrote:
Spectacular finding. However I am surprised that the interspecific introgession hypothesis is not evoked. There are numerous examples of massive interspecific mitochondrial introgression not accompanied by any detectable nuclear introgression (and here with three nuclear fragments, the power to detect it is very limited anyway). This would in my opinion be a much more plausible explanation than long term high effective population size, which should anyway leave even more marked traces in the nuclear genome. There would remain to find the donor species, but they may be extinct. An analysis of the coalescent in each of the divergent mitochondrial lineages segregating in a given species might give hints about which lineage is likeky to be introgressed, since the most likely source of massive introgression is during range expansion into the territory of another species, and this is expected to leave a signature of expansion of the lineage that introgressed from the species whose territory has been invaded.<br /> Sorry for the self-citation, but you could read this paper and several references therein:<br /> Melo-Ferreira, J., L. Farelo, H. Freitas, F. Suchentrunk, P. Boursot, and P. C. Alves. 2014. Home-loving boreal hare mitochondria survived several invasions in Iberia: the relative roles of recurrent hybridisation and allele surfing. Heredity 112:265-273.
On 2018-04-11 02:12:06, user Emily Stephen wrote:
Great paper, thanks for sharing! I think you have a mistake in the methods: "Each 200 ms epoch was multiplied with a Hann taper, zero padded to 1 s, and Fourier transformed, resulting in an FFT spectrum with a frequency resolution of 1 Hz." -- actually, the frequency resolution should be more like 10 Hz. With 200 ms windows and one taper, the half-bandwidth will be 1/0.2 = 5Hz. Zero-padding doesn't affect the frequency resolution, just the interpolation of the frequency axis.
On 2018-07-06 11:00:09, user kamounlab wrote:
In response to some comments we received, here is a comparison of the sequence chromatograms corresponding to Fig. 3. They show that MoT3 reverse primer sequences were recovered in amplicons from M. oryzae isolates including Bangladeshi wheat and rice blast fungi.
We conclude that:
The reverse primer showed mis-priming despite the single mis-match at the 3' extension end (based on FR13 sequence), allowing WB12-like sequences to be amplified.
There could also be degradation of primer at the 3' extension end that enabled amplification in rare cases: there is only one putative evidence (the double peak in chromatogram from RB-11).
The wheat blast isolate BR32 lacks the WB12 region.
Joe Win and Sophien Kamoun
On 2019-04-29 17:55:26, user Charles Warden wrote:
I hope we can find a way to get more comments on bioXriv, so that they could be discussed prior to submission to a peer reviewed-journal:
https://www.nature.com/arti...
I would much rather have a revised pre-print than a correction / retraction in a peer-reviewed paper.
You can see any comments for an individual from their Disqus account, but I think this worked well in terms of keeping a friendly tone and asking questions that I think could improve reader understanding: https://www.biorxiv.org/con...
On 2022-02-21 19:22:36, user MA wrote:
The supplements tables are NOT included?!
On 2025-01-14 04:06:08, user Yi-Cheng Yang wrote:
This study contributes to the establishment of personalized treatment, such as considering the use of EZH2 inhibitors combined with PSMA-targeted therapy for NE type II patients, providing new treatment options for cancer patients.
On 2018-11-14 09:36:55, user Carlos Santiago wrote:
Quite interesting paper. Do you plan to extend it to evoked-potentials <br /> as well? There's another pipeline that deals with evoked and <br /> resting-data that has been validated in both healthy and schizophrenia <br /> patients that you guys could discuss: "An automatic pre-processing <br /> pipeline for EEG analysis (APP) based on robust statistics".
Further, there are the new guidelines for EEG pre-processing on https://osf.io/a8dhx that you could discuss. Nice work!
On 2019-05-07 01:17:57, user Keith Robison wrote:
I've written a pair of analyses on this -- some key criticisms are the lack of technical detail and that the analysis of errors is much less detailed than desired. There's also the lack of specificity in the text as to which data was deposited publicly -- only the E.coli is available. Also, the phred quality scores are overestimated at the high end by perhaps as many as 5 points.<br /> Poking at Genapsys Preprint<br /> Genapsys' Base Caller: Mysterious, But Not Ideal?
On 2023-01-11 04:42:12, user Leslie Vosshall wrote:
Konopka et al. produce a valuable reagent for the Anopheles mosquito community – a QF2 knock-in into the bruchpilot (brp) locus. They use this strain to quantify the number of neurons in the major sensory appendages using an existing QUAS-CD8:GFP reporter strain. The images in the paper are beautiful and the cell counts are a valuable resource for the field. No one has attempted to do cell counts like this before, and this reagent made this possible.<br /> A few suggestions to improve the paper:<br /> 1) The authors have not formally shown that the brp-QF2w line is in fact pan neuronal. It would require significant additional work to prove this, e.g. double label antibody staining with RNA in situ hybridization against a pan-neuronal gene to show a 1:1 correspondence. I do not suggest that they do this, but it’s important to note the caveat early in the paper that the genetic reagent is assumed to be pan neuronal because the targeted locus is a neuronal gene.<br /> 2) Speculation on phenotypic/behavioral variability caused by variation in cell number (Line 283-299) seems premature to me. It could be variation in the expression of the driver or reporter, rather than underlying variation in the number of chemosensory neurons. More experiments would need to be done to confirm that what is seen with the genetic reagents reflects actual biological variability. I might suggest that this paragraph be toned down or removed.<br /> 3) Figure 2E-F, Figure 3E: could the authors clarify how the data are plotted and what the sample sizes are. I have the impression that the small dots are individual experiments, but it is not clear. For transparency, it might be best to not use bar plots and instead use dot plots where all of the data points are clearly visible.<br /> Review prepared by Leslie Vosshall
On 2015-04-04 02:08:22, user Rat_Fink_Forever wrote:
What percentage is showing up? I have 4.4% Denisovan according to the Human Genome Project and my near term history is from the Baltics, with 50% northern European and a hefty percentage of SW Asian.
On 2023-08-16 13:06:21, user Pierre-Luc Germain wrote:
Very interesting contribution, I'd just like to make two comments.
First, it's wrong to write that scDblFinder is "formerly known as doubletCells". They're two methods developed independently, and it's simply that doubletCells was moved to the same package, but still as an independent method.
Second, your results are in contrast with other benchmarks, which you explain by more "realistic scRNA-seq datasets". I'm obviously not entirely disinterested here, but I think this is very misleading: you don't show any evidence that the traditional benchmark datasets do have unrealistic patient or batch effects, and omit to mention the critical fact that, as far as I know, the fatemap samples are homogeneous cell lines, which is far from being more realistic (people do scRNAseq on complex tissues much more often than on cell lines). I think a fairer description would be to abandon the "realistic/unrealistic" labels, describe your data as it is, and hence that your observations are basically about homotypic doublets, which the tested methods are very bad at detecting (but also don't claim to do). The lack of real difference between adjacent/distant seems to indicate pretty clearly that you're essentially dealing with homotypic doublets.
On 2020-02-01 15:40:37, user Levi Yant wrote:
Magdalena Bohutinska and Mark Alston contributed equally.
On 2015-07-27 15:52:01, user Maria Zavodszky wrote:
Hi, Thanks for sharing this manuscript. I have found that the manuscript mentions supplementary tables that I could not find in the word document posted here under Data Supplements. I would be interested in seeing them. Is is possible?<br /> Thanks,<br /> Maria Z.
On 2018-04-12 18:47:01, user H. Etchevers wrote:
Because this paper is behind a paywall, I will try to upload a revised version that includes the five references that had been missed in the first authors' version.
On 2019-11-25 09:30:11, user Daniel Žucha wrote:
Dear readers, <br /> I would like you to be notified that this preprint has been already published in the Clinical Chemistry journal with minor changes. It is accessible under DOI: 10.1373/clinchem.2019.307835. The direct link to this site is forthcoming shortly.
On the behalf of authors,<br /> Daniel Zucha
On 2020-07-07 11:41:45, user Rhyothemis wrote:
"SARS-CoV is known to repress ACE2 expression [4]. ACE2 regulation involves chromatin remodeling and structural chromatin changes [19]."
Could this type of change persist post-infection?
On 2021-02-18 06:24:22, user Ruoying Zheng wrote:
I totally enjoyed reading this paper. The experiment designs are great. It would be better if some parts of the article can be improved. In Fig 5, the biological model should be always mice instead of using human erythrocytes in 5A and using infected mice in 5C. Having a consistent biological model can rule out unnecessary variables. If both mice and human biological models are used here, then a vitro experiment about mice erythrocytes malarial infection and related treatments should be added here. In 5C, infected erythrocytes should have a higher FITC-A fluorescent binding properties than uninfected erythrocytes. More detailed explanation should be added in 5C to clarify the difference between each group. In the linear graphs of Fig 6A and 6C, different groups should have different colors, which would make it easier to read. As for the cell pictures in Fig 6A and 6B, the color scheme is not unified, the colors of the parasites should be the same in each picture so it would be less confusing. Besides, more background information about DHA(active metabolite of all artemisinin compounds) and why the author set up experiments to test efficacy of DHA+Alisporia should be explained.
On 2018-11-28 10:17:24, user Tanai Cardona Londoño wrote:
Hi, interesting proposal. I like it. A couple of comments.
The fossil heterocystous cyanobacteria reported by Pang et al., (2018) are not just akinetes. They are entire filaments with cells that do resemble heterocysts. I spent all of my PhD studying heterocystous cyanoabcteria, purifying them, extracting their thylakoids membrane, staining them, seeing them in a variety of microscopes... I have to say that those filaments are excellently preserved and are virtually indistinguishable from extant heterocystous cyanobacteria. I would dare to say that the fossils presented by Pang et al., (2018) are unequivocal fossils of heterocystous cyanobacteria. But I'm not a paleontologist.
You cited the review by Butterfield (2015) to validate your statement that the best fossil heterocystous cyanobacteria are from the Devonian, but in that paper that is Butterfield's own assessment, which predated Pang et al.'s paper. The Devonian fossil's cited by Butterfield are reported in a 1959 paper that I was not able to access. Were you able? Are those truly better preserved that Pang et al.'s? Butterfield does not show the Devonian fossils in his review... So, your argumentation there can be strengthened. Don't be so quick to dismiss Pang et al.'s fossils!
Your proposal also makes me wonder about the light-independent protochlorophyllide reductase. It is a nitrogenase-like enzyme and it is also oxygen sensitive (http://www.plantphysiol.org... "http://www.plantphysiol.org/content/142/3/911.short)").
Could it be that the oxygen sensitivity of protochlorophyllide-reductase limited the rise of oxygen prior to the Great Oxidation Event, before the diversification and expansion of today's taxa of cyanobacteria, and before the origin of the light-dependent protochlorophyllide reductase?
Thanks.
All the best,<br /> Tanai
On 2023-12-15 19:31:50, user Jordan C Rozum wrote:
This preprint has been accepted in PRX Life under a new title "Models of cell processes are far from the edge of chaos" and is openly accessible here: https://doi.org/10.1103/PRX...
On 2020-02-08 07:31:36, user jean-claude perez wrote:
Please read https://www.preprints.org/m...
On 2020-02-01 15:50:25, user ??? wrote:
.. Is this suggesting that the primary Coronavirus infects to HIV patients in Wuhan and mutated with transferring from hiv gene ?? Very aweful scenarios but possible.
On 2020-04-13 08:00:30, user Tartaglia Lab wrote:
This work is interesting and we find quite useful that the authors shared it. Thanks!
In our work (https://www.biorxiv.org/con... "https://www.biorxiv.org/content/10.1101/2020.03.28.013789v3)") we studied protein interactions with SARS-CoV-2 RNA using advanced computational approaches.
Just focusing on the RNA binding proteins present in the two studies, we found a significant overlap of genes such as Janus kinase and microtubule-interacting protein 1 JAKMIP1 (Q96N16), A-kinase anchor protein 8 AKAP8 (O43823) and A-kinase anchor protein 8-like AKAP8L (Q9ULX6), which in case of HIV- 1 infection is involved as a DEAD/H-box RNA helicase binding protein (among others).
It is very curious that our list of protein- RNA binding partners contains elements identified also in this protein-protein network analysis. Yet, it must be mentioned that ribonucleoprotein complexes evolve together and their components sustain each other through different types of interactions.
On 2025-04-04 09:28:15, user Volkmar Lessmann wrote:
Great work by the authors!! High profile research disentangling the role of phospholipid metabolism in rescuing AD phenotype with FTY720. Congratulations!
On 2021-02-18 21:31:48, user Dr. Tyeen C Taylor wrote:
This article is in review at Frontiers in Forests and Global Change
On 2015-06-03 14:54:48, user Kasper Hansen wrote:
This preprint was revised June 3rd, 2015. The major change in the revision is analysis of single cell epigenetic data (both ATAC-seq and WGBS). This has led to a change of abstract, introduction, a new results section and discussion; these changes simply reflect the additional data types. We have also included a very short analysis of the overlap of A/B compartments with various types of methylation domains (as has been previously done in for example Berman et al (2012) Nature Genetics. Typos etc. have been corrected and three new figures have been added.
On 2019-03-11 10:00:25, user Justin Andrushko wrote:
Fantastic paper investigating the cortical underpinnings of fatigability.The things I really like about this paper - no salami slicing! The authors conducted multiple experiments to investigate the observed mechanisms. The authors also included effect sizes on all statistical measures, something more people should consider to include. Effect sizes really help with data interpretation and meaningfulness of results. Great paper!
On 2020-03-06 22:44:50, user Luis Yáñez wrote:
this is a veyr useful paper, hopefuly will be published soon
On 2022-06-30 16:45:44, user Tatiana Mikhailova wrote:
Is raw .idat data from this study available for download?
On 2014-08-03 13:59:42, user Richard Rocca wrote:
Can you please post what where European samples ETR2, ETR5 and ETR9 are from and their archaeological context?
On 2018-03-30 13:00:18, user Markku Varjosalo wrote:
This preprint was published in Nature Communications on 22th of March titled as “An AP-MS- and BioID-compatible MAC-tag enables comprehensive mapping of protein interactions and subcellular localizations”
On 2016-11-22 07:13:13, user ???? wrote:
Thank you for your work,here I had some questions when I installed the package.When I install the package by :<br /> source("https://bioconductor.org/bi...") <br /> biocLite("fgsea")<br /> I got some errors like :<br /> fastGSEA.cpp: In function ‘Rcpp::IntegerVector combination(const int&, const int&, std::mt19937&)’:<br /> fastGSEA.cpp:318: error: ‘uniform_int_distribution’ is not a member of ‘std’<br /> fastGSEA.cpp:318: error: expected primary-expression before ‘int’<br /> fastGSEA.cpp:318: error: expected ‘;’ before ‘int’<br /> fastGSEA.cpp:324: error: ‘uni’ was not declared in this scope<br /> make: *** [fastGSEA.o] Error 1
Could you help me ? Thanks.
My R version is 3.3.1,and bioconductor is 3.4
On 2017-11-22 10:54:04, user Tristan Croll wrote:
Nice work! It will be very interesting to see how the results compare with our modelling (DOI 10.1080/07391102.2016.1165631).
On 2025-06-17 16:33:06, user Olivia Fromigue wrote:
Hello,<br /> This manuscript is now published:<br /> C-terminal binding protein-2 triggers CYR61-induced metastatic dissemination of osteosarcoma in a non-hypoxic microenvironment.<br /> Di Patria L, Habel N, Olaso R, Fernandes R, Brenner C, Stefanovska B, Fromigue O.<br /> J Exp Clin Cancer Res. 2025 Mar 5;44(1):83. doi: 10.1186/s13046-025-03350-6.<br /> PMID: 40038783
On 2020-08-26 13:28:16, user Qingtian Guan wrote:
This manuscript is now accepted in the International Journal of Infectious Diseases. We have updated the manuscript in pre-proof format, please refer to the following link for citation for the details: https://www.sciencedirect.c...
On 2016-08-23 15:43:05, user Danny wrote:
Raw data now available at http://www.ebi.ac.uk/pride/...
On 2017-08-25 16:20:58, user kamounlab wrote:
"...a signature of positive selection in candidate effector genes in S. reilianum is a poor indicator for the identification of genes with virulence functions"
Please see https://twitter.com/KamounL...
On 2025-05-17 06:44:22, user 11 wrote:
Summary<br /> The manuscript “An online GPCR drug discovery resource” describes an online resource of GPCR drugs, clinical trial agents, targets and disease indications. This resource offers unique reference data, analysis and visualization, and is availed as a new section, ‘Drugs and Agents in trial’ integrated in the GPCR database, GPCRdb. Furthermore, it includes a target selection tool for prioritization of receptors for future drug discovery.<br /> The major weakness of the paper is that the paper fails to include olfactory receptors in the database, the reliance on Open Targets disease association scores might miss novel hypotheses with weaker genetic backing. The validation of the newly introduced selection tools and visualizations, how the prioritization recommendations compare to existing approaches or human expert selection are unclear.<br /> This paper helps identify strategies and trends in current GPCR drug discovery and give insights into which already drugged, or yet untapped targets have the largest potential in specific diseases.<br /> Major Points<br /> 1. Validation of the Target Selection Tool<br /> The target selection tool offers a powerful yet swift means to prioritize GPCRs for future drug discovery based on disease indications, characterization, tissue expression and more. While there is no validation to show the tool’s performance. How does the tool perform when testing a now-successful GPCR target before it was clinically pursued? Consider revising by running the tool on historical data and show how it would have prioritized GIPR before the approval of tirzepatide.<br /> 2. Missing Method Comparison<br /> You described several new visualization methods (e.g., GPCRome wheel, intersecting Venns, Sankey plots) but how these tools are different from existing tools are not explained. Why are these tools better than existing tools such as those in Open Targets, ChEMBL, or DrugBank? consider adding a contextual comparison section to clarify the advantages and disadvantages of those tools, explain the innovations of the new visualization methods.<br /> 3. Disease Classification and Filtering<br /> The disease annotation relies on ICD-11 mapping from Open Targets (using EFO/HPO/MONDO). While manual curation of disease terms is not clearly defined. Adding a supplemental table listing these modifications would be great.<br /> 4.Exclusion of Olfactory Receptors Have Limitations<br /> Your research excludes olfactory receptors--a large family of GPCRs which play essential roles in cancer, reproduction, and metabolic regulation. Databas such as CORD (Comprehensive Olfactory Receptor Database) provides better annotations of olfactory receptors than those in GPCRdb, ligand binding and diseases linkage are also included. Including olfactory receptors in your research may reveal potential drug discovery opportunities.
Minor Points<br /> Technical Questions<br /> 1.Definition of "Agent" vs. "Drug" should be explained in the Abstract or Introduction section.<br /> 2.Explain why do you choose 0.5 as the association score cutoff from Open Targets.<br /> 3. The classification rules of “pharmacological modality” of agonist, antagonist and allosteric modulatorare not clear.<br /> 4. Non-human GPCR targets (e.g., mouse models) are not included.<br /> Stylistic Issues<br /> 1."the platform contains 516 drugs, 337 agents…" is later repeated again in Figure 1 text.<br /> 2. “bioactivity data” and “bio-activity” are used inconsistently.<br /> 3. PDSP Ki database is used without prior expansion.<br /> Unable to Assess:<br /> Data integration are made from tools like Pharos, GTEx, and the Human Protein Atlas, especially for expression-based filtering. I cannot offer expert feedback on the transcriptomic expression atlas validation and the correctness of the tissue expression normalization procedures.<br /> Final Reflection<br /> This paper made great contributions to the GPCRs field by offering an online resource of GPCR drugs, clinical trial agents, targets and disease indications. The platform will help streamline drug development pipelines, helps identify strategies and trends in current GPCR drug discovery and give insights into which already drugged, or yet untapped targets have the largest potential in specific diseases.
On 2018-08-22 14:18:07, user Skeptical Scientist wrote:
Interesting application of machine learning!
On 2023-04-17 07:08:00, user Lance wrote:
Hello,
I have looked through all of your dataset files, and did not see the cell type and subtype annotations (i.e., cluster labels) for the cells anywhere, including in the adata.obs field. Was there a mistake in uploading the data?
Also, I noticed that in Supp Table 2, all the entries are 0. Was this also a mistake?
Thank you! Looking forward to being able to access the actual cell type labels!
Best, <br /> Lance
On 2023-10-27 14:47:25, user Joseph H Vogel Beckert wrote:
"To add to this uncertainty, the pilot test coincided with international discussions on the fair and equitable sharing of benefits from the access and use of digital sequence information (i.e., genomic sequences) under the Nagoya Protocol adding increased uncertainty surrounding the legal compliance landscape57."
There should be some mention of "unencumbered access" through the proposed modality of "bounded openness over natural information". The sentence above references a Comment from Nature Communications that trumpets "de-coupling" access from benefit-sharing. "De-coupling" means independence and is probably not what its 41 authors meant. Similarly, any reference to a multilateral mechanism for ABS without recognition of the overarching implications of the economics of information, i.e. the justification of "economic rents", introduces bias and thus undercuts the presumed scientific neutrality of the manuscript..
On 2019-08-16 08:02:18, user WJR wrote:
Bug Report:
This (preprint) paper by Hickey and Golding relies on a software simulation. (Available at: https://github.com/gbgolding/evolutionSex)
There is a bug in the currently posted version of that software. It occurs in the file "sexual7.c" (seen August 16, 2019). The bug strongly decreases the computational efficiency of the simulation, and slightly affects the results.
In that file, there is a structure integer variable named '.sex', which is initialized to zero, and tested several times by IF-statements, but it is never changed. In other words, it does nothing. That is the first clue something is awry.
(Note: For some reason, when I try to post the offending code here, it gets displayed as an unreadable mess. I don't know why. I tried placing the appropriate code formatting brackets around it. So, instead I must here describe where the bug occurs.)
Lines 233 through 252 comprise a While-loop, which creates each progeny by a mating of some parent_i with some other parent. However, the loop then proceeds to OVERWRITE that progeny's allele data by a mating with EVERY OTHER parent. The original parent_i's allele data gets obliterated within that progeny, because it gets over-written many times. Each and every progeny is computed by mating each parent with EVERY OTHER parent. But only the last matings count, as the previous matings get over-written. This is exceedingly inefficient computationally. If the population size is n, then the computer time increases with n-squared, rather than n.
The end result is that each progeny is indeed the result of a random pairing of parents, but not the ones the simulation-writers intended. Moreover, the simulation aims that each parent be involved in AT LEAST a minimum number of reproductive events (given in the code by "FECUNDITY"), but that goal is not achieved. Due to randomness, some parents can mate numerous times, while others don't mate at all -- contrary to the stated design of the simulation. There is a disparity between what the code intends to do, and what it actually does, and this can affect the results.
I'm guessing the variable .sex is a vestigial remnant of code (now largely absent) that had originally matched each parent with exactly one other parent (i.e., for an obligate monogamy model). I imagine .sex was originally a flag, used to indicate that a given individual has (or has not) been used yet as a parent. This approach would be one of the simplest ways of guaranteeing that each parent has the fecundity claimed in the paper.
On 2022-03-08 02:07:09, user Jimin wrote:
Live demo of chromatin architecture prediction:<br /> https://nyu.c-origami-previ...
On 2022-03-08 02:03:59, user Jimin wrote:
Link to the project website:<br /> https://tanjimin.github.io/...
On 2020-06-13 20:44:48, user Henrique dos Santos Pereira wrote:
Would anyone answer my question, please? Would the variation in frequency of these more virulent variant of the virus correspond to a trade-off virulence x transmission over time and thus also explains why velocity of death declines (mortality) while morbidity keeps accelarating in the affected populations? henrique.pereira.ufam@gmail.com
On 2018-06-14 11:38:18, user GUILLAUME GAUTREAU wrote:
Little typo in algorithm 1, line 11: the indice and exponent ("y" at the top and "out" at the bottom) of delta are not coherent with the delta exponent and indice ("in" at the top and "i" at the bottom) in definition 1
On 2013-12-31 01:57:24, user Jacob G Scott wrote:
some discussion here: http://mathematicaloncology...
On 2019-12-29 08:15:34, user Levi Yant wrote:
Correspondence should go to James Higgins or Levi Yant.
On 2016-04-14 14:29:53, user lepisorus wrote:
if the authors can prove that the retrotransposon proliferation is one reason leading to their special reproduction way, that will be fantastic.
On 2017-01-20 19:39:06, user James Jun wrote:
Thanks for your interest all. The manuscript was uploaded in a hurry to meet the grant deadline and still there are some work left to do. JRCLUST will be professionally supported by Vidrio Technologies, creator of ScanImage, and will be maintained as free and open-source software based on Matlab.
On 2019-04-03 03:51:05, user Ann wrote:
The pitfalls are obvious, lacking in vivo validation and non-specific capturing.
On 2020-04-28 20:27:16, user Matthew Bogyo wrote:
This work is now published at Cell Reports Medicine : DOI:https://doi-org.stanford.id...
On 2021-05-05 11:07:02, user Milka Kostic, PhD wrote:
Dear authors, <br /> Thank you for sharing this interesting preprint with the community. Below are some more detailed comments that ay have others appreciate your work better. I congratulate you on an excellent piece of work. <br /> Kind regards, <br /> Milka
COMMENTS ON THE PREPRINT BY Dölle, Adhikari et al. <br /> Targeted protein degradation is a very active field at the moment. Many efforts in this area are focusing on transforming known ligands (binders, inhibitors) of proteins with a clear disease relevance into bifunctional (PROTAC-based) degrader molecules. Unlike the traditional antagonist/inhibitor based compounds in preclinical and clinical use that diminish (inhibit) activity of the target, these degrader molecules induce selective degradation of the target. Thus, they remove the target from the proteome. This type of pharmacological activity could be a real benefit when the target in question plays significant scaffolding roles, by engaging multiple binding partners using different regions and binding sites. In such a case, inhibiting individual protein-protein interactions would be highly impractical. However, if the target is degraded, all these PPIs would disappear together with the target!
Dölle, Adhikari et al. select one such target - WDR5, a protein that performs different scaffolding roles (i.e. binds different partners) in the context of epigenetic regulation. Because of this, WDR5 has been implicated as a target for drug development and couple of compounds that inhibit WDR5 mediated PPIs have been described. These compounds served here as a starting point for WDR5 selective degrader development. The authors used existing structures of WDR5 bound to the PPI inhibitors to identify surface exposed areas of the molecules that could be modified for degrader molecule development. In brief, each PROTAC (bifunctional degrader) includes a ligand for the target and a ligand that recruits an E3 ubiquitin ligase, connected via a linker. The linker is known to have an impact on the performance of PROTACs and the authors use three chemically distinct types of linkers (PEG based, aliphatic and aromatic). The nature of the E3 ligase is also a major factor that affects degraders' activity, and the authors start by incorporating ligands for cereblon (CRBN), VHL and MDM2. Altogether, they generate number of PROTAC-based degraders featuring different linkers and different ligases.
They describe detailed validation steps of their degraders which included: <br /> - Measuring in vitro (biochemical) affinity between WDR5 and degrader molecules using ITC, showing Kd values in low nM. They also tested binding via DSF and observed some differences between results from ITC and DSF, which they provide likely explanations for (I encourage you to read the preprint as the authors provide an important technical note).<br /> - The authors tested that degraders were cell permeable and that they engaged the target using BRET. This is an important step in validation as degrader molecules tend to be larger, leading to concerns that may have difficulty entering cells. <br /> - They provide evidence that their degraders induce target degradation in cells, including under endogenous conditions. Importantly, they show that negative control compounds (always critical to have on hand) show no activity, and that inhibiting proteasome rescues observed degradation. Additionally, they confirm that mRNA levels of WDR5 did not change, thus further validating that the reason for decrease in protein levels is due to degradation. (They also include additional pieces of evidence that effects on WDR5 protein levels are degradation dependent) <br /> - Also importantly, the authors show selectivity by quantitative proteomics and demonstrate that WDR5 is the only protein depleted out of more than 5800 identified after 9 hours of treatment (while treatment with individual ligands did not have this effect) - Lastly, they show anti-proliferative effects in MV4-11 cells of their best performing degraders (these compounds were VHL-based PROTACs). However, the concentration needed for cellular effects was high (10uM). The authors then showed that this is due to low levels of VHL present. When they overexpressed VHL, the growth inhibitory activity improved.
Overall, the work is of high quality and includes appropriate steps for degrader validation. This gives high confidence that WDR5 degraders described in this work are useful as probes for WDR5 biology. For example, what happens to histone methylation once WDR5 is removed? Does removal of WDR5 lead to destabilization (or stabilization) of some of its binding partners (proteomics results suggest that this may not be the case, but would be interesting to dig deeper into this question)? What happens to transcription? What effect does this have on MYC activity (MYC family is known to engage with WDR5)? I am sure the authors and the community have these and many other questions in mind, and I look forward to seeing what new biology they and others can discover with this new generation of tool compounds in hand.
On 2020-09-01 09:25:13, user Sean Munro wrote:
I not think that this paper reports an "interactome" - it reports a "proximityome". BioID will label many proteins that simpy happen to be in the same compartment as the protein tagged with the biotin ligase without neccessarily interacting with them. Thus a BioID version of a SARS-CoV-2 protein that is in the Golgi will biotinylate many Golgi residents even if it only interacts with a subset of with them.
On 2020-09-10 21:07:07, user F.Li wrote:
For cells mentioned in each figure, the figure legend provides hyperlinks to neuuPrint where more detailed information about these cells can be obtained. These hyperlinks work in the PDF version. So if you are interested, please check out the PDF version of this paper.
On 2024-01-03 20:27:28, user Peyton Lab wrote:
I think the links in the figure legends are broken - not working from the browser pdf.
On 2020-10-22 14:47:26, user Matthew Terry wrote:
Very interesting paper. Would it be possible to also take into account the cost of expressing the genome? I would imagine that this would also work in favour of gene transfer. For genes retained, is protein turnover as equally important as abundance in the energy equation?
On 2020-05-16 09:13:37, user standardito wrote:
A great paper about the spreading of a naturally selected variant of SARS-CoV-2.
On 2020-11-25 12:05:29, user Mark Hanson wrote:
The collaborative group of Huang et al. (in preparation) is now available online at the link below. This is a manuscript written by Jianqiong Huang and her supervisors and collaborators at the University of Strasbourg and Sino-French Hoffmann Institute, and also the Platform Biopark d'Archamps.
On 2018-10-20 04:51:55, user koooo wrote:
GWAS101: please share the list of GWAS hits in a table format.
On 2017-05-13 17:45:40, user Anthonie Muller wrote:
Outside mitochondria, but still in the cell, smaller temperature gradients of a few degrees have been detected, for instance:<br /> (1) Jui-Ming Y, Haw Y, Liwei L. Thermogenesis detection of single living cells via quantum dots. 2010:963-966.<br /> (2) Yang J, Yang H, Lin L. Quantum dot nano thermometers reveal heterogeneous local thermogenesis in living cells. ACS Nano 2011;5:5067-5071.<br /> (3) Okabe K, Inada N, Gota C, Harada Y, Funatsu T, Uchiyama S. Intracellular temperature mapping with a fluorescent polymeric thermometer and fluorescence lifetime imaging microscopy. Nature Communications 2012;3:705.<br /> (4) Kucsko G, Maurer P, Yao N, et al. Nanometre-scale thermometry in a living cell. Nature 2013;500:54-58.<br /> (5) Bai T, Gu N. Micro/nanoscale thermometry for cellular thermal sensing. Small 2016;12:4590-4610.<br /> (6) Qiao J, Mu X, Qi L. Construction of fluorescent polymeric nano-thermometers for intracellular temperature imaging: a review. Biosensors and Bioelectronics 2016;85:403-413.
Are these thermal gradients 'real'? Some argue that they cannot exist, given the known value of the thermal conductivity of water. So there is a controversy here:<br /> (1) Baffou G, Rigneault H, Marguet D, Jullien L. A critique of methods for temperature imaging in single cells. Nature Methods 2014;11:899-901.<br /> (2) Kiyonaka S, Sakaguchi R, Hamachi I, Morii T, Yoshizaki T, Mori Y. Validating subcellular thermal changes revealed by fluorescent thermosensors. Nature Methods 2015;12:801-802.<br /> (3) Suzuki M, Zeeb V, Arai S, Oyama K, Ishimata S. The 10^5 gap issue between calculation and measurement in single-cell thermometry. Nature Methods 2015;12:802-803.<br /> (4) Baffou G, Rigneault H, Marguet D, Jullien L. Reply to. Nature Methods 2015;12:803-803.<br /> The same arguments of Baffou et al may apply to this reported high temperature inside the mitochondrion.
On 2019-04-04 04:13:45, user Nimród Hunor Attila Árpád wrote:
Avars were the siberians, Hungarians were volga bolgars.
On 2023-01-17 21:10:46, user Gregory Way wrote:
Hi Daniel,
It was our pleasure to review. Thank you for posting!
Here are some comments regarding your very speedy reply:
Thanks again!<br /> Greg
On 2016-05-27 15:36:35, user Kevin Watson wrote:
6W/kg, 9 hours a day, for 2 years. With that level of exposure, I'm surprised their blood didn't boil first.
This relates to real-world circumstances how, exactly?
On 2018-12-05 09:19:23, user Julien Racle wrote:
Hi,<br /> great paper, a thorough and fair comparison of the deconvolution methods was indeed needed.
One important question that also arises in the field is to what extent the reference profiles that have been derived from tumor-infiltrating lymphocytes that infiltrate one tumor type (e.g. melanoma) can be used for samples from another tumor type (e.g. ovarian cancer), or even if reference profiles derived from blood are sufficient. In the paper from Schelker et al., Nat. Com., 2017, they argued that it was important to use reference profiles coming from the same tumor type than the bulk.<br /> But from your data it seems that it doesn't really matter so much (as most methods have reference profiles derived from blood or melanoma TILs and your analysis includes also ovarian tumors (in this optic, EPIC could additionally be tested with the blood-derived reference profiles)). To further verify this, it would therefore be interesting if you build some mixes where you take only the cells that originated from one of the tumor type at a time instead of mixing together the TILs from melanoma and ovarian.
Additionally, CAFs and endothelial cells have been less studied by the deconvolution methods, but due to their potential importance in cancer, it could be nice to include them also in your table 2, to help researchers interested by these cell types.
Best wishes,
Julien
On 2025-11-26 05:26:36, user Prof. T. K. Wood wrote:
Please cite the seminal paper that initiated research on the impact of bacteria-derived indole on human physiology: http://www.pnas.org/cgi/doi/10.1073/pnas.0906112107 <br /> This manuscript was the first to find indole tightens epithelial cell junctions.
On 2018-12-29 09:52:19, user Alexey Semyanov wrote:
Event based paradigm has been around for a while. In 2013 we have already discussed the weaknesses of ROI based imaging versus event based imaging https://www.ncbi.nlm.nih.go...
More recently I have reviewed the works in the filed https://www.ncbi.nlm.nih.go...
On 2023-05-16 09:25:26, user pierre wrote:
As the MRNA cannot enter the nucleus, there is absolutely no chance than it can interact with the DNA. Furthermore, even if MRNA was by some miracle be in presence of DNA, interaction would require a specific reverse transcriptase, as you know that there is not one RT, but one for any MRN, which come associated with the RNA of the retroviruses.
On 2020-12-13 23:25:13, user Alex Crits-Christoph wrote:
Could the authors release a BAM or list of mapped reads (including read quality information and mapping information) of the chimeric sequences they show? Ideally a BAM filtered to just chimeric sequences would be good. This would help evaluate whether these sequencing reads represent real biological events.
On 2020-04-05 16:08:32, user Ivan Kosik wrote:
Exciting paper, when do you guys plan to publish/upload sequences for Abs in genebank?
On 2021-08-24 19:42:40, user Julie Hanson Ostrander wrote:
Use this link to access a view-only version of the article for free and use Enhanced PDF features such as annotation tools, one-click supplements, citation file exports and article metrics. https://rdcu.be/cv1jC
On 2025-10-18 20:59:56, user CDSL JHSPH wrote:
This paper provides a clear and quantitative analysis of plasmid copy number (PCN) across thousands of bacterial genomes. The authors confirm a universal scaling law between plasmid size and PCN, showing that plasmid DNA load is conserved relative to chromosome size. I found the idea of “replicon dominance” in multi-replicon plasmids particularly interesting, as it explains how merged plasmids resolve replication conflicts. The study is significant because it formalizes long-standing assumptions about plasmid replication using a large comparative dataset. I wonder if the authors have performed any wet-lab experiments to test the “replicon dominance” rule in controlled conditions. I am looking forward to seeing how this line of research progresses!
On 2024-05-18 21:03:14, user Camilla Forsberg wrote:
This preprint has now been revised and published in CELL:<br /> https://www.cell.com/cell/f...
On 2020-06-26 16:00:55, user ChrisdeZilcho wrote:
The sensitivity of SARS-CoV-2 to Interferons is a very interesting observation with regard to its viral evolution. <br /> Type I - IFNs are normally produced by lymphocytes (NK cells, B cells and T cells), macrophages, fibroblasts and endothelial cells from all mammals as an important component of the immune response against viruses. Homologous IFN molecules have also been found in birds, reptiles, amphibians and fish species. IFN is therefore an essential part of an effective antiviral immune response. It activates surrounding virus-infected and non-infected cells, which consequently form proteins (RIG-I, MDA5, TLRs), which inhibit further (virus) protein synthesis in those cells and on the other hand cause the degradation of viral RNA. IFN-? has previously been used therapeutically in the treatment of chronic viral hepatitis for several years.
Bats were shown to elicit a particularly strong immune response against viruses through activation of IFN-pathways. (Cara E. Brook et al., eLife 2020;9:e48401): <br /> “The experiments and model helped reveal that the bats’ defenses may have a potential downside for other animals, including humans. In both bat species, the strongest antiviral responses were countered by the virus spreading more quickly from cell to cell. This suggests that bat immune defenses may drive the evolution of faster transmitting viruses, and while bats are well protected from the harmful effects of their own prolific viruses, other creatures like humans are not.” https://elifesciences.org/a...
So if the virus multiplied in a natural environment in mammals, bats in particular, it would be expected that it would have developed counter-mechanisms to IFN in its viral evolution. This is clearly the case with SARS-CoV. The "old" SARS-virus, which originates in bats and allegedly jumped to later intermediate hosts (civets/raccoon dogs), does not appear to be as sensitive to recombinant IFN as its "new" relative. SARS-CoV-2 is much more sensitive to recombinant Type 1 IFN in cell culture. This was similarly shown by Emily Mantlo et al. "Antiviral activities of type I interferons to SARS-CoV-2 infection", Antiviral Res. 2020 Jul; 179: 104811. https://www.ncbi.nlm.nih.go...
Interestingly, these studies, as well as in numerous publications before the outbreak in 2019, used the IFN-?/? -defective Vero E6 cells to cultivate SARS CoV. The kidney cells from African Green Monkeys lack the ability to produce Type I Interferon (IFN) (Naoki Osada et al., DNA Res. 2014 Dec 21(6): 673–683.). The cell line is popular not only due to its IFN-deficiency, but because of its ACE2 expression on the cell surface and similarity to human epithelial cells, many research laboratories worldwide have used them for years in the cultivation of natural and artificially generated SARS viruses in the laboratory.
It has been shown previously that the Vero E6 cell line proved to be particularly permissive towards SARS-CoV-2 - more than any other cell line tested with a standard CPE assay. The Vero E6 cell line is used not only in virus research, but also routinely in the production of vaccines for rotaviruses, inactivated polio vaccines, and for Japanese encephalitis vaccine.
The results above suggest that SARS-CoV-2, unlike its relative SARS-CoV-1, developed in an environment where IFN did not seem to play a role. However, since virtually all mammals use IFN in their immune response (bats in particular), why is CoV-2 so sensitive in contrast to CoV-1? What does it mean in terms of its evolution in mammals? Would that explain the lower virulence of CoV-2 compared to CoV-1 in most patients that actually develop mild symptoms? Would antiviral IFN-drugs prove to be effective against CoV-2 such as Avonex®, Rebif®, Plegridy®, Betaferon®, Extavia®, Intron-A®, Roferon®-A and is IFN-? more effective than IFN-??
I would be interested in the opinion of scientists in the field, since my only conclusion would be, that SARS-CoV-2 may not have developed in an environment, where Interferons play a major role in the hosts immune defence. Of course this is purely speculative.
On 2024-06-17 06:43:17, user Sebastian Gregoricchio wrote:
Now published on Nucleic Acids Research:<br /> https://doi.org/10.1093/nar/gkad267
On 2017-01-03 15:08:41, user John Didion wrote:
We reviewed this paper in our December preprint journal club. Overall, we found the paper to be well written and the conclusions to be convincing. We had only a few minor comments and suggestions:
· Please be more clear about what the coding score in Figure 3B and 4C means. It is difficult to move from the results to the methods to interpret the CS_hexamer_ equation, so it would help your readers if you give a more intuitive interpretation of this value right in the results. Also, how did you determine that 0.049 is the cutoff for high coding score?<br /> · It would have been nice to see two distinct tissues compared in figure 4B, given that one might expect “brain” and hippocampus to be fairly similar. If this would be an incorrect assumption, then it should be spelled out why, otherwise one or more confirmatory figures should be included in the supplement. Also, how did you choose 60% as the cutoff? Just by eye? <br /> · Please add coding genes to figure 4C.<br /> · Figure 2B could be improved by adding density plots in the margins with asterisks indicating significance (such as those provided in Figure 4E).<br /> · We were interested to see the effect of the algorithm for predicting coding potential. Do things change significantly if you use e.g. CPAT rather than CIPHER?<br /> · In the discussion, you focus on lncRNAs as a potential intermediate step leading to de novo protein coding genes. Isn’t it equally likely that lncRNAs (especially those that are highly conserved) were at some point functional and are degenerate in mouse? If yes, please consider this in the discussion, otherwise add a short explanation as to why this can’t be so.
Sofia de Pereira Barreira<br /> Steve Bond <br /> John Didion<br /> Tony Kirilusha<br /> Luli Zou
On 2018-03-21 18:56:40, user Sandeep wrote:
1) Fig 3 has the wrong gM -<br />
3-GGTGTACACGCCGGAGTAGTCGG-5 <br />
It is however correct in the search (SITable 3).
2) It has one mismatch with 2 diff (not 0)<br /> chr15: 99250216 (+ve strand) <br /> GGCTGATGAGGCCGACACACG <br /> GGCTGATGAGGCCG - CACATG
Neither s/w - nor CIRCLE-seq found this. Worrying.
3) "Several off-target sites contained mismatches in the protospacer adjacent motif ( PAM ) sequence, with NAG PAM as the most prevalent ( Fig. 1e and Supplementary Table 1 ), consistent with data from previously<br /> published studies" -
Several? Its 86%. Only 14% has the NGG.
Most would be more apt. Once again, very worrisome from an off-target point of view.
On 2021-10-15 20:43:00, user Swineheart wrote:
I am wondering why this paper is stuck in preprint status. I can review if needed, having already rerun all the analysis independently.
On 2018-01-28 23:42:40, user Blake Stamps wrote:
Thank you for the manuscript! One small thing- in your abstract, the link is incorrect, and leads to nowhere. Should it be http://microbiology.se/soft...
On 2020-05-07 15:21:51, user Jean-Michel Fustin wrote:
The data presented in this preprint is now published in Communications Biology at https://www.nature.com/arti...
On 2020-03-26 00:17:43, user Peter Dunn wrote:
Interesting study, but the abstract needs some editing. There are words missing. eg " <br /> SAK models more logistically feasible" should be SAK models WERE more logistically feasible.
On 2018-03-05 03:04:51, user PascualMarquiRD wrote:
^In disagreement with your suggested conclusion, we prefer another version, and note that there is no error in this conclusion either: "In Moiseev et al Neuroimage 2011, 2013, 2015, their Eq.2 with LCMVB weights, gives an estimate for the unknown amplitude of source 'i'. But this estimator is not good, you can't use this if your goal is localization. You can only use this if you know that only one source is active in the whole brain". <br /> ^Next: you are wrong. The bug you wish for in my code is not there. This does not exclude the possibility of other bugs.<br /> ^About the super-optimality of the MV filter: I find it funny that you have to start with the condition "…once the true location is established…". What does this mean? You need to know the unknown localization first, and then there is some sort of optimal property? But this defeats the whole aim of functional localization.<br /> ^One more thing: All the methods were compared under equal conditions, for the unknown current density orientation case. Where is the unfairness?<br /> ^And a final question/comment: CONNECTIVITY. What form of LCMVB signals are typically used for connectivity analysis? In two papers at least, (Hipp et al 2012 Nature neurosc. 15:884) and (Brookes et al 2012 Neuroimage, 63:910), they use Eq.2 from Moiseev et al Neuroimage 2011, 2013, 2015! And these LCMVB signals, under the assumption of distributed activity (not assuming 1 or 2 single dipoles), produce a very highly significant rate of false positive connections.
On 2018-01-25 21:34:43, user Casey Greene wrote:
This work appears to be interesting. However, it would have been nice to have some contextualization with the existing work in the field.
There's some work from our group on gene expression + autoencoders on bulk data.
Tan J, Ung M, Cheng C, and Greene, CS. Unsupervised feature construction and knowledge extraction from genome-wide assays of breast cancer with denoising autoencoders. Pac Symp Biocomput. 2015; 20:132-43. PMID:25592575
Tan J, Hammond JH, Hogan DA, Greene CS. ADAGE-based integration of publicly available pseudomonas aeruginosa gene expression data with denoising autoencoders illuminates microbe-host interactions. mSystems. 2016 1(1):e00025-15.
Tan J, Doing G, Lewis KA, Price CE, Chen KM, Cady KC, Perchuk B, Laub MT, Hogan DA, Greene CS. Unsupervised extraction of stable expression signatures from public compendia with an ensemble of neural networks. Cell Systems.
Way GP, Greene CS. Extracting a Biologically Relevant Latent Space from Cancer Transcriptomes with Variational Autoencoders. bioRxiv. 10.1101/174474
Tan J, Huyck M, Hu D, Zelaya RA, Hogan DA, Greene CS. ADAGE signature analysis: differential expression analysis with data-defined gene sets. BMC Bioinformatics.
Off hand I also know about some work by others on bulk data:
Learning structure in gene expression data using deep architectures, with an application to gene clustering<br /> Aman Gupta, Haohan Wang, Madhavi Ganapathiraju
Leveraging Stacked Denoising Autoencoder in Prediction of Pathogen-Host Protein-Protein Interactions<br /> Huaming Chen ; Jun Shen ; Lei Wang ; Jiangning Song
Learning a hierarchical representation of the yeast transcriptomic machinery using an autoencoder model<br /> Lujia Chen, Chunhui Cai, Vicky Chen and Xinghua Lu
Finally there's at least one paper on related approaches for single cell data:
Interpretable dimensionality reduction of single cell transcriptome data with deep generative models<br /> Jiarui Ding, Anne E. Condon, Sohrab P. Shah
As a reader, it would be very helpful if at least some of this work, especially the prior single cell work, was provided to help contextualize the advance described in this paper.
On 2021-01-09 14:43:25, user Arlin Stoltzfus wrote:
Nice work. I have some questions. The main argument of the paper is that a case of extreme parallelism is caused by extreme non-uniformity of rates of mutation, rather than by extreme non-uniformity of fixation probabilities caused by fitness differences. (1) Why is there no measurement of the rate of the A289C mutation with and without the enhancing context? (2) Why does the title of the paper refer to synonymous sequences? Saying that synonymous sequences facilitate parallel evolution is a very strange way of reporting extreme parallelism caused by a mutational hotspot.
On 2017-06-27 13:17:02, user Myron Best wrote:
In reply to the follow-up comments, we feel the arguments raised by Dr. Chakraborty do not make sense, thereby once more erroneously interpreting our work.
First, we once more aim to emphasize that the biological mechanisms contributing to the TEP RNA profiles are not exclusively based on RNA sequestration from both cancer, immune and stromal cells, but also splicing of endogenously expressed RNAs. As we only included intron-spanning RNA-seq reads for our analyses, the increase of F13A1, a bonafide platelet gene, can be explained by enhanced splicing of this RNA in platelets of patients with cancer. We observed low levels of MET using the shallow thromboSeq protocol. However, sequestration of RNAs by TEPs does likely only contribute minorly to the RNA profiles, as compared to induction of RNA splicing, and such MET transcripts will only be confidently detected once you sequence deeper. Second, to ensure the specificity of our classification algorithms, esp. the pan-cancer classification algorithm, we performed independent validation of the classifier in a cohort of which samples were not involved in algorithm development. In addition, to ensure specificity of the gene panels and classification algorithms, we randomly permutated the group labels of the samples assigned to the training cohorts resulting in random classifications in the validation cohort / left-out samples in LOOCV. This contradicts the suggestion by Dr. Chakraborty that the classifications are caused by random assignment of counts. Finally, in Dr. Chakraborty's first comment we aim to highlight the following sentence: 'RNA-seq values certainly show no over-expression (on the contrary - but leaving that aside, since surrogacy does not require them to be there)'. This urges us to conclude that indeed MET or other tumor-derived biomarkers do not necessarily need to be detected in TEPs via the current thromboSeq protocol, thereby undoubtedly suggesting that all three manuscript posted by Dr. Chakraborty should be retracted.
Best wishes,<br /> Myron Best<br /> Thomas Wurdinger
On 2020-05-27 15:22:47, user Esmeralda R. wrote:
This is a great preprint. <br /> Can't wait to see the final version of it. But I'm already planning to use it to discuss with my labpeers in a virtual journal club<br /> Grama Esmeralda
On 2025-05-10 17:20:18, user sebastiangregoricchiophd wrote:
Now published on Genome Biology:<br /> https://doi.org/10.1186/s13059-025-03596-5
On 2021-04-15 08:31:36, user Alexander Kastaniotis wrote:
In contrast to inactivation of the ACP1 gene encoding acyl carrier protein in yeast, a knockout of the PPT2 gene encoding phosphopantetheine transferase in Saccharomyces cerevisiae is viable (e.g. Merz S, Westermann B. 2009. Genome-wide deletion mutant analysis reveals genes required for respiratory growth, mitochondrial genome maintenance and mitochondrial protein synthesis in Saccharomyces cerevisiae. Genome Biol10:R95-2009-10-9-r95). This would argue for a non-essential role of the PPT group also in yeast. We discussed this in a recent review (Kastaniotis AJ, Autio KJ, R Nair R.Mitochondrial Fatty Acids and Neurodegenerative Disorders.Neuroscientist. 2021 Apr;27(2):143-158).
On 2024-12-27 18:54:27, user ML Gaynor wrote:
This preprint was 'Just Accepted' (12/17/2024) and will be available here: <br /> https://doi.org/10.1086/734411
On 2020-04-22 08:41:51, user Ural Yunusbaev wrote:
Which viewer did you use to create Figure 2?
On 2018-01-15 09:41:54, user David Curtis wrote:
Overall, this seems a very interesting paper. However there are two relevant analyses of the Swedish dataset which are not cited:
https://www.biorxiv.org/con...<br /> https://www.biorxiv.org/con...
The first of these is now published:
http://onlinelibrary.wiley....
Both papers show that missense and non-singleton variants contribute to risk in the Swedish dataset and also point out an important problem. There is an excess of subjects with a substantial Finnish ancestry component among cases compared with controls. What this means is that if one includes all subjects and does a burden test using rare variants then a variant which is common in Finnish subjects will be commoner in cases. Here is an example from the second paper: "An example was COMT, with SLP=7.4. On inspection, it seemed that this gene-wise result was largely driven by SNP rs6267, which was heterozygous in 51/6242 controls and 94/4962 cases (OR=2.3, p=8*10-7). However this variant is noted in ExAC to have MAF=0.002 in non-Finnish Europeans but MAF=0.05 in Finns. Hence, its increased frequency among cases appeared to be due to the excess of cases with Finnish ancestry."
Another problem with the Swedish dataset is that there are in general fewer singleton variants among the subjects with Finnish ancestry. This produces significant complications when trying to interpret the results of singleton analyses. (Again, this is discussed in the second paper.)
In order to address these issues, we used a reduced dataset in which subjects with substantial Finnish ancestry were excluded. However it is not clear to me that the methods of analysis used in the current paper would be robust against this potential source of artefact. It would be reassuring if this issue could be explicitly addressed.
On 2020-05-10 01:31:42, user Chris Enitan wrote:
This was a good read.<br /> I Wonder how many threads/electrodes would be needed to map the entire human brain in the long run and what physical constraints that might bring. For now though, this is very exciting stuff.
On 2023-08-31 13:39:20, user Gregory Voth wrote:
Dear Authors,
We congratulate you for your work on simulating lipid droplet biogenesis at the MARTINI coarse-grained resolution. We also thank you for citing three papers from our group. However, I am leaving this comment because our papers were not adequately nor accurately cited in your manuscript.
First, we have already shown that asymmetric tension decides a budding direction in J Phys Chem B 126 (2022): 453-462 using our simulations. This is consistent with your findings, and none of your text mentioned this.
Second, we have already carried out a large-scale coarse-grained simulation of lipid droplet biogenesis with seipin, published in Elife 11 (2022): e75808. This includes not only nucleation but also maturation and budding. We have further found and discussed the critical role of seipin transmembrane segments in maintaining a neck structure. In particular, based on our simulations, we proposed a mutant construct, which was further validated by experiment in our paper. The final structure of our CG molecular dynamics simulations is consistent with the experimental structure. In that regard, our work has been cited in your paper only for nucleation but did not receive proper credit for budding and maturation. In particular, we disagree with the following two sentences in your manuscript:
"The function of seipin is also not completely clear: simulations and experiments suggested that it may trap triglycerides (13-15), therefore affecting LD nucleation and growth by ripening, but its localization at the LD-ER contact site raises questions on a possible role also in the budding process.”
"LD nucleation and phase separation were observed in simulations before (7,13,22,23,38), and occur on fast time scales (below the microsecond); in contrast, the budding process has never been observed so far, neither in simulations nor experimentally."
I hope our concerns are properly addressed during revision so that we do not have to write a comment to the journal in which your paper will be published. Thank you.
Gregory Voth
On 2020-03-25 15:30:06, user Sinai Immunol Review Project wrote:
Rhesus macaques were immunized intramuscularly twice (week 0 and week 4) with SV8000 carrying the information to express a S1-orf8 fusion protein and the N protein from the BJ01 strain of SARS-CoV-1. By week 8, immunized animals had signs of immunological protection (IgG and neutralization titers) against SARS-CoV-1 and were protected against challenge with the PUMC-1 strain, with fewer detectable symptoms of respiratory distress, lower viral load, shorter periods of viral persistence, and less pathology in the lungs compared to non-immunized animals.
The authors should write clearer descriptions of the methods used in this article. They do not describe how the IgG titers or neutralization titers were determined. There are some issues with the presentation of data, for example, in Figure 1a, y-axis should not be Vmax; forming cells and 1d would benefit from showing error bars. Furthermore, although I inferred that the animals were challenged at week 8, the authors did not explicitly detail when the animals were challenged. The authors should explain the design of their vaccine, including the choice of antigens and vector. The authors also do not include a description of the ethical use of animals in their study.
The authors describe a vaccine for SARS-CoV-1 that could benefit from a discussion of possible implications for the current SARS-CoV-2 pandemic. Could a similar vaccine be designed to protect against SARS-CoV-2 and would the concerns regarding emerging viral mutations that the authors describe as a limitation for SARS-CoV-1 also be true in the context of SARS-CoV-2?
On 2018-04-24 20:14:39, user John Goertz wrote:
Interesting article, it's an intriguing approach. I'm always excited about ways to get around microfluidics!
Some thoughts:
Figure 2b is very hard to interpret. The gel beads are nearly invisible, so it's hard to tell what's oil, what's water, and what's bead. It would benefit from fluorescence imaging, maybe FAM-labeled hydrogel, aqueous-phase Texas Red, and oil-phase Nile Red, Oil Red-O, or DiD. This would also enable estimation of the thickness of the aqueous "shell" around the beads.
This shell thickness is important, since the shell volume, not total engulfed volume, limits target genome (and cell) capture. Let's say your 50 um diameter beads are engulfed in 55 um diameter droplets, and that satellites form 3% the total aqueous volume (note, in the text you say <3%, in Figure 2 you say <5%). Then the satellite fraction of the total satellite and shell volume, i.e. the volume inhabited by the target genome, is (0.03*27.5^3/0.97)/(27.5^3-25^3) = 12%. At 5% total volume fraction, this becomes (0.05*27.5^3/0.95)/(27.5^3-25^3) = 21%. Still viable for ddPCR, but now it's contributing a non-negligible error to your concentration estimates, and is a larger contribution than the variation in encapsulating-droplet volume.
Standard error may not be appropriate for Poisson estimations given the assumption of normality. Better would be to propagate the Poisson error (and the satellite-volume error) of each individual measurement across the averaging.
On 2018-03-06 14:21:30, user Banks Lab wrote:
Suggestions, comments or other feedback welcome.
On 2024-06-18 15:19:14, user Todd Gaines wrote:
This preprint has now been published in Genome Biology:<br /> https://link.springer.com/a...
On 2017-10-12 20:50:26, user Jonathan Dry wrote:
FYI we have released (as part of a DREAM challenge) a very large cell line combination screening dataset. I believe a biology-led approach to predict response could have an edge in these data, and it would be very interesting to see how this mechanistic model performs. You can request the data here https://openinnovation.astr.... Also a chance to benchmark vs the machine learning methods used within the challenge itself https://www.biorxiv.org/con....
On 2024-07-31 11:50:30, user Leyli Borner wrote:
This article has been published in Neobiota journal: https://doi.org/10.3897/neo...
On 2017-01-20 22:13:22, user German Dziebel wrote:
The paper resonates with my long-standing critique of mtDNA, Y-DNA phylogenies and the out-of-Africa theory. See, e.g., http://anthropogenesis.kins...
On 2025-11-18 22:59:11, user Marco Wu wrote:
Well written article!
On 2022-05-18 15:58:33, user Carly Boye wrote:
Very interesting work! I noticed you considered variables such as age, stage, and surgery when collecting your samples. Did you collect data on ancestry as well (or investigate this in any way)? One of the things I appreciated about #BoG2022 was the diversity of the samples used for some of the projects because I think it is important to study diverse populations. Do you think we might uncover new mutational processes (associated with specific outcomes/phenotypes) in studying more diverse populations?
On 2025-11-05 10:13:41, user Gregory Ehx wrote:
This article is now published in Methods in Molecular Biology https://link.springer.com/protocol/10.1007/978-1-0716-4430-0_17
On 2020-02-28 10:55:51, user Laurent Thomas wrote:
Very nice tool, it could deserve a dedicated Fiji update site ! Maybe it could also benefit from the new ROI group attribute available with the latest ImageJ core releases. See https://forum.image.sc/t/ho...
On 2017-11-08 18:18:22, user Gregory Connor wrote:
Updated version https://www.biorxiv.org/con... …<br /> discusses prewhitening of the dependent variable (phenotype) for univariate GWAS regression.
On 2021-04-21 21:32:49, user Manendra wrote:
That's an amazing work which will be really helpful... Is it possible to increase the number of approved drugs (not just 2016). Atleast 10 years of FDA approved drugs... But this is a very good start
On 2018-12-06 21:57:02, user Devang Mehta wrote:
This preprint references Supplementary Tables that are not provided. I request the authors to upload a complete document.
On 2019-02-26 13:10:37, user Laurentius Huber wrote:
Please find a formatted version of this response letter with figures here: https://goo.gl/3czXWG
Response Letter:<br /> We thank the referees for reviewing our manuscript entitled “Sub-millimeter fMRI reveals multiple topographical digit representations that form action maps in human motor cortex”. The critical reading of this manuscript is highly appreciated, and we believe that the comments have helped to improve the manuscript and clarify the interpretation of the presented results. The manuscript has been modified according to the reviewers’ suggestions.<br /> All points raised by the reviewers have been addressed in detail below.
Reviewer #1:<br /> R1.1 <br /> This is a very interesting study investigating the spatial organization of hand movement representations in M1. Certainly the hand representation in M1 is likely complex and therefore requires advanced methods to probe. Both imaging and neurophysiological evidence clearly suggests that M1 is not so much concerned with the representation of fingers, but rather of complex hand movements. The use of a winner-take-all map for fingers is therefore likely a less effective way of gaining a deeper understanding of the organization of M1.
We thank the reviewer for his/her expert assessment and for appreciating the necessity of advance methodology to investigate the complex representations in M1.
We would like to comment on the reviewer’s statement that “imaging and neurophysiological evidence clearly suggests that M1 is not so much concerned with the representation of fingers, but rather of complex hand movements”. We agree that there is imaging and electrophysiological evidence that parts of M1 can represent complex hand movements. However, we take issue that it would be established that the entire M1 must behave like this. We believe this is only part of the entire picture. <br /> In fact, physiological support of the control of the mentioned “complex hand movement” and muscle and movement synergies comes from investigations of cortico-motoneuronal (CM) cells, (CM cells are the ones with motor neurons innervating shoulder, elbow, and finger muscles). Note, however, that these representations and these cells are confined to the caudal part of M1 (also known as the “new” M1 or Brodmann area BA4p). This is the evolutionary younger part of M1 that is located deep in the central sulcus. In this part of M1, individual body parts are largely overlapping (probably to facilitate complex hand movement) and a finger dominance maps might be misleading (as the reviewer suggested).
However, we would like to note that there are no such CM cells in the rostal M1 (Rathelot and Strick, 2006, 2009). As pointed out in Fig. S9 of or manuscript, the new finding of mirrored finger representations are solely visible in the rostal M1 (a.k.a. “old” M1 or BA4a). In this evolutinary old part of M1, body part movements (e.g. hand, elbow, shoulder) have locally distinct domains with less overlap compared to BA4p.<br /> Thus, we respectfully disagree with the reviewer about the effectiveness of finger dominance maps. These maps are extensively used in imaging and electrophysiology and have efficiently lead to important findings throughout the last century (Woolsey 1979; Hlustik 2001; Idovina 2001; Sanes 1995; Penfield 1937; Schieber 1993; Schellekens 2018; Olman 2012; Siero 2014). We don’t want to discredit this large body of literature of body part maps. And we would also like to use the tool of finger dominance maps, when appropriate.
We would also like to point out that at no point in this analysis, we are estimating “winner-takes-all maps”. We are aware of the shortcoming of winner-takes all maps and thus, the finger-dominance maps that we are depicting in many figures, are not binary. Instead, our finger-dominance maps are shown with a continuous color scale. Every voxel has a relative regime (from 0 to 1) of how much it is dominated from that finger. This analysis retains the fact that multiple fingers can be represented in the same voxel.<br /> For even more quantitative interpretations, (e.g. to avoid that the color of one fingers covers the color of another fingers that is more weakly represented) we included Fig. 3B that shows the mirrored representation in column profiles.
The methods presented in this paper are carefully applied and well documented. In fact the authors have made the tools and data available in an open repository, for which they are to be commended. I really have no quibbles with the processing or VASO approach, both of which have extensive prior publication history.
We thank the reviewer for recognizing the importance of investigating the organization of M1 and we are delighted that the reviewer considers out methods adequate.
R1.2 <br /> The paper is clearly written and illustrated. However the crux of the problem lies in the extent of the novelty of the imaging sequence versus the lack of novelty in the neuroscience findings. Certainly practioners of VASO have made a convincing argument for its superiority over GE-EPI BOLD for the localization of function at the mesoscopic scale and I certainly am convinced of that. Nonetheless researchers around the globe have used GE-EPI to look at various columnar structures in animal and human brain with some degree of success. While the results in this paper are the amongst the clearest, the spatial resolution doesn't really go beyond what Cheng et al. used in their Neuron paper in 2001. So while VASO is certainly a viable and perhaps better alternative to BOLD, this manuscript doesn't really advance the MRI side of the equation much beyond what these authors and others have already shown.
We thank the reviewer for appreciating the clarity of the manuscript and for appreciating the value of VASO in high-resolution fMRI.<br /> Given the reviewer’s doubts about the novelty, we would like to explicitly point out the methodological advancements we achieved and novel neuroscience finding that we found.
Methodological Novelty:<br /> We agree with reviewer, that previous studies could already achieve sub-millimeter in-plane resolutions. Note, however that previous papers (including the Cheng paper) relied on flat portions of cortices and collapsed the third dimension along 3-4mm thick MR-slices. This means that precious MRI methods to investigate “columnar” alignment where not applicable across people and certainly not across the entire precentral M1-gray matter bank with its characteristic Omega-like folding pattern. VASO has never before proven its applicability for sub-millimeter “columnar” imaging. And certainly not for along the curved cortex. This is a novel achievement. <br /> We agree with the reviewer that we could previously already show indications of layer results (with submillimeter in-plane resolution). Please note however, that our previous methodology was limited to a very small FOV of less than 3cm in read direction and less than 2cm in slice direction, resulting in a coverage that could only capture 0.8% of the cortex. In previous studies, this was sufficient to address research questions about individual chunks of the cortex. However, it is not sufficient for topographical mapping of “columnar” organization. One fundamental achievement of this study is that we developed a fundamentally new acquisition approach that allows us to achieve 22% of brain coverage. This was achieved with the novel development of advanced readout strategies. As such, we invested two years of development for the inclusion of advanced GRAPPA reconstruction, asymmetric echoes, and corresponding reconstruction to image space. Compared to our previous methods, the resulting coverage is more than an order of magnitude bigger. This is fundamentally novel and enabled the present study in the first place. <br /> In this study we developed a fundamentally new analysis methodology. The corresponding LAYNII software package used here allows columnar and laminar signal pooling in the voxel space of the native EPI space. There is no other analysis method that can achieve this. While there are previous automatic software packages (e.g. FreeSurfer, CBS-Tools etc.) that allow similar analysis steps, they are not suitable to detect ‘columnar’ structures that are smaller than 1mm (5 digits in 3mm) within the curved cortex. These methods require closed surfaces (not possible with, partial brain coverage), alignment with ‘anatomical’ data (which requires spatial resampling=blurring). Previous methods work in vertex space (not voxel space) and thus are associated with resolution loss during spatial resampling, which makes the neighboring finger representations merge and disappear. The mirrored finger results are only as clearly visible with all the above analysis advancements. And thus, we consider these advancements as a fundamental methodological novelty. <br /> Other methodological analysis novelties developed here are the columnar smoothing without signal leakage across sulci, laminar Point-spread function estimation (Fig. S3, S8), layering in 3D with isotropic voxels (not only 2D as previously), cortical unfolding in voxel space.
Biological novelty<br /> With respect to the referenced study from Cheng et al., we would like to point out that they showed patterns that resembled the expected shape and size as columns but never established such structure and organization. There is no expected ground truth of ocular dominance columns alignment (e.g. where to find which columns). This is different for our study. We can differentiate between any random columnar pattern compared to a meaningful somatotopic organization, with neighbouring fingers being represented in neighbouring columns. This form of meaningful columnar mapping at submillimeter scale is novel compared to Cheng et al.<br /> As opposed to previous columnar fMRI studies, we do not simply try to depict known structures with known shape and size as proof-of-principle for a method as previous studies. Instead here, we are finding previously unknown organization principles of sub-millimeter representations in M1. This is a fundamentally new approach and a paradigm shift for the field of “columnar” and “laminar” fMRI. <br /> We report fundamentally new neuroscientific insights about how the previously described action representations in the microscopic regime are integrated into previously described body-part representations in the macroscopic regime This was not described until now and is a fundamental novelty of this study.<br /> We agree with the reviewer that previous studies (including Ejaz et al.,) found deviations of the homunculus model. It is not clear until now, however, how these deviations (multiple representations and fractionalizations) are coming about. Are these deviation of the linear body-part alignments just randomly aligned? Or do the deviations follow a specific geometric order? If yes, which one? According to which order are the movement actions aligned? In this study we find -for the first time- mirrored representations of individual digits in the primary motor cortex that are differently engages for different actions. This is novel and has not been described previously.
In the revised version of the manuscript, we tried to stress the novelty of the study.
R1.2 <br /> So we are left with the importance of the neuroscientific findings, and here I have some more serious issues. The organization of M1 and S1 along an action-axis is well known and certainly not as mysterious as the authors would represent.
We agree with the reviewer that there are previous accounts of action representations in the motor cortex. We are describing them as part of our introduction and discussion section. We did not intend to describe them as ‘mysterious’ by any means. The point that we are trying to make is that these action representations are partly in conflict with somatotopic organization principles that are found in most of the high-resolution imaging literature (e.g. Schellekens 2018; Olman 2012; Siero 2014).
In the revised version of the manuscript, we emphasize the [Ejaz et al., 2015] even more in a dedicated paragraph about it.
R1.3 <br /> Furthermore, they have dismissed a paper that shows a similar result using MRI by misrepresenting the findings of that paper as I understand them (Ejaz et al., 2015, Nature Neurosci). <br /> Specifically, in reference to that paper, Huber et al. state that 1) the work argues for a simple topographic arrangement of single finger representations in S1, and 2) that the overlap between finger activation patterns is "due to noise". In that work (Ejaz et al., 2015), they used BOLD fMRI to measure the activity patterns evoked by single- and multi-finger movements in M1 and S1. The spatial arrangements of these patterns in both regions were stable within each participant (compared across different scanning sessions), but highly variable across participants. These finger patterns are shown in Fig. 1 of that paper. Close visual inspection of the patterns reveals they do not follow a clear linear arrangement in either S1 or M1, and perhaps some evidence of digit "mirroring" can be observed - definitely there are parts of the cortex activated for the thumb at the dorsal end of the hand region.
They then calculate the dissimilarity between all pairs of finger patterns for M1 and S1, separately. Importantly, the relative dissimilarity between any pair of activity patterns (within a participant) was highly stable across participants. This is notable given the spatial arrangements of these patterns was highly variable across individuals. One stable characteristic was that the thumb pattern was more similar to the little finger than to the ring finger. This finding clearly shows - contrary to what Huber et al. claim it shows - that a simple linear somatotopic arrangement cannot account for the digit representations in M1 or S1.
1.) Our justification for the statements in the previous version of the paper:<br /> We assume the reviewer refers to the citation on page 5 of the original manuscript:
“In the primary somatosensory cortex, we find no clear deviations from the homunculus model as shown previously in humans (Ejaz 2015; Schluppeck 2017; Olman 2012; Kolasinski 2016; Shellekens 2018).”
This statement in our manuscript was based on the following paragraph in [Ejaz et al., 2015] from page 1034:
“There was some consistency: when averaging activity patterns across participants (Fig. 1), a blurry somatotopic arrangement became visible with the thumb activating more ventral and the other fingers more dorsal areas of the motor strip.”
Figure caption: adapted screenshot from Fig. 1 of Ejaz et al. Subject average activation maps show rough features of linear somatotopic arrangement (with secondary deviations). Thumb representations peaks at the bottom (pink arrow) and the remaining fingers are linearly aligned with the little finger representation peaking at the top (red arrow).<br /> We also noticed indications of a secondary thumb representation in Fig. 1 of [Ejaz et al., 2015] next to the index finger. We discussed these double-thumb indications in the Ejaz et al. figures extensively among ourselves and eventually decided not elaborate on them in our manuscript for the following reasons:<br /> In our own pilot studies, we noticed that for some kinds of thumb movement tasks, the thumb-movement can come along with unwanted secondary wrist movement. This was not the case for index/middle/ring/pinky-finger movements. Since the wrist movement representations are expected to be located next to the pinky-finger, we were sceptical that the secondary thumb representation form Ejaz might actually refer to unwanted wrist movement?<br /> In our own BOLD data, we find some cases of signal leakage from S1 to M1 (across the central sulcus), which might introduce artifactual double representation in M1. Since, Ejaz et al., also used BOLD sequences, we speculate that this might have been the case in those data too? <br /> The text of the paper [Ejaz et al., 2015] does not discuss the secondary blob at all. Neither does it mention it in the context of a potential double-representations or mirrored representation. Thus we are hesitant to include it as a reference for this feature. If would be more appropriate for us to give the authors of [Ejaz et al., 2015] full credit for the discovery of mirrored representations, if they would have described it and discussed it consistently across people.
It is further to note that the above statement in our preprint referred to the sensory cortex, not the motor cortex.
Revision to avoid future misunderstandings:<br /> We think this misunderstanding can be resolved by removing the [Ejaz et al. 2015] citation on page 5. Instead we discuss the paper in more depth on page 7.
R1.4 <br /> Furthermore, they (Ejaz et al.) go on to show that the stable structure of overlap of finger representations in M1 and S1 can be accounted for by the statistics of everyday hand movement. They did not interpret the spatial variability of these patterns as "noise due to inter-individual variability in every day hand movements". On the contrary, the statistics of hand use they showed is stable across individuals (also see Ingram et al., 2008, Exp. Brain Res.), as is the organizing principle underlying the spatial organization of activity patterns in M1 and S1.
1.) Justification for our statements in the previous version of the paper:<br /> We assume the comment from the reviewer refers to the following section of our manuscript on page 6:
“Previous studies by Sane et al. (1995) and by Ejaz et al. (2015) already identified deviations from linear organizations for finger representations in the human motor cortex with GE-BOLD at 2.5 mm and 1.4 mm resolutions, respectively. However, without the localization specificity, a consistent spatial layout principle, such as the mirrored finger representation alignment, was not found. Instead, the exact pattern of overlapping and segregated representations was interpreted as noise due to inter-individual variability in every day hand movements (Ejaz 2015).”
We included this interpretation of Ejatz’ results based on the first few sentences of the discussion section in [Ejaz et al., 2015] on page 1039:
“The relative similarities between activity patterns were preserved across individuals, despite the substantial spatial inter-subject variability of the activity patterns themselves. The representational structure remained invariant even when the shared somatotopic arrangement of the digits was removed from the data. This suggests an organizing mechanism that shapes the overlap between patterns without enforcing a regular spatial layout. The representational structure could be predicted by the natural statistics of hand use.“
If we understand the highlighted section correctly, Ejaz et al. found that there are deviations from a simple somatotopic organization. And the patterns of these deviations have a considerable variability across people. It is not clear, however, according to which consistent organization principle this variability comes about.
In our view, we thus (mis-)described the phrase “inter-individual variability without given structure” with the term “noise due to inter-individual variability”.
Revision to avoid future misunderstandings:<br /> We agree that the term “noise due to inter-individual variability” might be misleading to describe “inter-individual variability”. In the revised version of the manuscript, the corresponding section is revised as follows:<br /> A previous study by Ejaz et al. (2015) already identified deviations from linear organizations for finger representations in the human motor cortex with GE-BOLD at 2.5 mm and 1.4 mm resolutions, respectively. These data already showed some indications of multiple finger representations (e.g. Fig. 1 in (Ejaz et al. 2015)). However, these data were not discussed with respect to an alternative geometric somatotopic organization principle such as a mirrored representation.
R1.5 <br /> I definitely agree with the authors that M1 organization is more complex arrangement than simple linear finger organization. Whether the organization really is best described by two discrete finger maps with phase reversal, however, really has to await a more rigorous experimental and statistical evaluation than even what is presented in Huber et al. Whatever the answer may be, however, I do think that the improved specificity of VASO sequence may play an important role in uncovering such representations in the future, but I don't feel that what has been shown goes much beyond what is known from the literature already.
We are glad that the reviewer agrees with our work showing that the M1 representations can be complex. We agree that the literature needs to be augmented with more rigorous studies.<br /> In fact, with the manuscript at hand we intent to do just that: providing a more rigorous experimental evaluation. We aim to move beyond the position of Ejaz et al. Namely, we aim to go beyond the conclusion “that the motor cortex is more complicated than individual finger representations”, . and describe how it is different, how these differences are geometrically organized, and whether they are stable across people.<br /> Accounting also the large bulk of electrophysiological and micro-stimulation evidence about the body-part sub-divisions in M1 we opt to see how these representation are in agreement with the results from Ejaz.<br /> In previous imaging studies (including Ejaz et al.,) it was common to view M1 as one large chunk of cortex that would follow the same architectonic principle. There is a large body of invasive literature, however, that suggests that this is not correct, neither functionally (Rathelot and Strick, 2006, 2009) nor anatomically (Geyer 1996). Thus, we intend to describe the body-part representations with a more rigorous fine-scale evaluation. To get there, we developed the advanced methodology as described here. And we start to describe the simplest movement principle of the literature (finger tapping) in the simplest part of M1, namely the evolutionary “old” M1 that has been described as body part representations. <br /> Thus, we feel that our findings go beyond what it known form the literature already.
Reviewer #3: <br /> General Comments: <br /> This paper uses the vascular space occupancy (VASO) method of measuring cerebral blood volume (fMRI) to explore the somatotopy of the finger representation at a sub-millimeter resolution in M1 and S1 of humans. This is an important problem as prior fMRI papers exploring this issue did not have sufficient resolution to adequately address a fine grained topography for fingers. This paper appears to have adequate resolution (~0.8mm) to make a major contribution to understanding the topography of the hand in M1 as well as S1. As such, this paper is primarily one of anatomical location and fMRI reconstruction. In addition, it addresses the issue of whether a given body part representation is always active when that body part is moved. The answer is that there is functional specialization within each M1finger representation. The figures are complex and it is paramount that their display is straightforward, consistent and simple to understand.
R3.1. The stated goal of this paper is to"non-invasively investigate the functional organization topography across columnar and laminar structures in humans", particularly M1 and S1. To understand the topography of the fingers in M1, the entire extent of the finger representations in M1 must be accurately mapped. Such maps are shown in Figs. 6S and 10S. These maps, for each participant, could form the core of an important paper, but they belong in the main body of the paper. They also need to be shown systematically for each participant. The data showing the columnar organization of M1 and S1 seem like important validating information for the reconstruction of the central sulcus. Some of this could be moved to the Supplementary information. What is currently displayed in Figs. 1-5 is just a small sample from the entire extent of slices through M1. Although the concept of mirror hand representations derived from single slices is appealing, it is only represents a small fraction of the entire map of the central sulcus. Furthermore, the single fMRI slices totally ignore the finger representations present in the depth of the central sulcus.
We would like to clarify our goal of this study. We feel the quoted section was taken out of context. As mentioned in the abstract, it was not our goal to ‘investigate the complete topographical organization of the motor cortex at its entirety’. Instead, the quoted section comes from an introductory sentence that states that our goal actually was to ‘develop imaging and analysis methodology, which -in principle- allows us to investigate topographical features’. In a next step we then use the M1/S1 system as a test bed to investigate the neuroscientific usefulness of that methodology. Given that we find -previously not described- neuroscience findings of the mirrored digit representation, we think that the neuroscientific usefulness it confirmed. In this sense, we see our manuscript to lie along a fine line between a methods paper and neuroscience paper.
We agree with the reviewer that every figure in the Manuscript and the Supplementary information is “tuned” to a specific message that we want to bring across. We further agree that Figs. 1-5 in the main manuscript are just a small sample of the main story and there is much more information to be seen. We don’t see this as a weakness of the manuscript. But as a means to follow the comment R3.14, namely selectively showing figures that have a specific message, which comes across as intuitive as possible.
In order to discuss the mirrored pattern of digit representations, we find it most natural to zoom into the hand area (Fig. 1). Correspondingly, when it comes to showing the inter-participant consistently of this feature (Fig. 2), we find it advantageous to use the same imaging procedure across all people as in Fig. 1. However, when it comes to explaining where these features are located across the dimensions of the central sulcus, we show additional unzoomed images. <br /> We agree with the reviewer that entire maps of the unflattened sensory-motor-system would give a more comprehensive view. However, it would distract the reader from the feature of interest. Those entire maps would mostly contain nothing (e.g. all the non-stimulated body parts, trunk, face, feet, etc.) and the 3-8mm of interest would be tiny (e.g. See Fig. S6). <br /> To address the reviewers comment, we included the full maps of the central sulcus into the manuscript main body (new figure 3), additional to the zoomed images.<br /> Furthermore, we included additional IMAGIRO maps (as requested) of for more participants with zoomed and unzoomed sections to guide the reader which part of the superior part of M1 it refers to (See new Fig. S6E).
The of laminar and columnar fMRI is still emerging. Thus, not all potential sources of analysis artifacts are fully described and understood. To minimize potential misinterpretation it has been suggested to depict the final results as close to the raw data as possible (Polimeni 2017; Kay 2019). Thus we try to show the activation maps in the raw EPI space (Fig. 1,2,4), when possible. This way, it can be easily be directly appreciated that the mirrored finger pattern is not an artifact of a flawed infolding artifact. Furthermore, the activity maps in EPI space best depict the spatial scale of columnar size with respect to the cortical thickness and location at the hand knob. Flattened maps are produced by several additional steps and are presented in an very abstract space where, these reference dimensions are lost. Thus, we are hesitant to remove the activation maps on the folded cortex from the manuscript. However, we included additional unfolded flattened maps in the supplementary material.
Please note that we are also required to following the Journal’s Guidelines to only include material that is central to the narrative. In doing so, we follow the rule of not having more than double of supplementary figures as figures in the main text. Thus, is included the some of additional maps as figure-panels, not as additional stand-alone figures.
We revised the manuscript to account for the reviewer’s comment. Specifically, we rephrased the abstract and introduction section to make our goals clearer. We also tried to make it clearer what the message is for each figure, in the figure captions respectively.
Kay, K., Jamison, K., Vizioli, L., Zhang, R., Margalit, E., & Ugurbil, K. (2019). A critical assessment of data quality and venous effects in sub-millimeter fMRI. NeuroImage, 189, 847–869. http://doi.org/10.1016/j.ne... <br /> Polimeni, J. R., Renvall, V., Zaretskaya, N., & Fischl, B. (2017). NeuroImage Analysis strategies for high-resolution UHF-fMRI data. NeuroImage, (April), 1–25. http://doi.org/10.1016/j.ne...
R3.2. The orientation of brain images and reconstructions should be the same in every figure. For example, Fig. 1A and 1E seem to have the right side of the brain image toward the right whereas Fig. 1B-D has it to the left. In Fig. 6S, the orientation of the CS appears to be opposite to that shown in Fig. 10S. Continually forcing the reader to flip the images creates unnecessary confusion. Since this paper shows the right hemisphere, left/medial should be on page left and right/lateral should be on page right. The terms medial and lateral are preferable to left and right. In Figs. 6S, 10S, the actual location of the medial wall/sagittal fissure should be indicated. Without this marker, the CS just floats in space with no anchor to the actual brain image. A calibration should be included on each image.
We agree that the orientation is confusing. This comes from the fact that the convention of MRI images is to view them as they would look like from the experimenter perspective. E.g. looking at an axial cut from the perspective of the participants feet. The right motor cortex of the person is then depicting on the left. This is contradicting to the 3D-head-models from viewing from above. Thus, the 3D-views and the 2D-views were confusing.<br /> Based on the reviewers comments, we tried to make it more consistent in Fig. 1, S6 and S10. This means however, that the 3D-head-models are mirrored representations compared to their real-live pendants. <br /> We included additional calibration markers and the landmarks of the medial wall in multiple figures. E.g. Fig. S6, S9, S3.
R3.3. The term 'multiple' is used incorrectly throughout the manuscript. Multiple means 'more than 2'.
We respectfully disagree with the reviewer on this point. In our understanding, the term ‘multiple’ refers to ‘more than one’ (source: https://en.oxforddictionari... "https://en.oxforddictionaries.com/definition/us/multi-)"). We chose this term deliberately vague. We find only two mirrored representation consistently across all participants. However, we cannot exclude the possibility that there are more representation hidden below the detection threshold. Since absence of evidence is not the same as evidence of absence, we would like to refrain from calling it “double” representation. This excludes the possibility of a third or fourth representation. <br /> In one participant, with a large tilting angle, and with a very low threshold, we see indications of a third representation. However, since its not reproducible across participants, its discussion is subject to future experiments with more sensitive imaging methodology only.
R3.4. It is unclear how the images in Fig. 1E were developed. What do the colors mean? Why is this representation shown here when it is not used until Figs. 3S, 6S.
Fig. 1 was intended as a figure describing the methods applied in this study. Thus, we included the coordinate system of layers and columns in 3D-grids as they are used for the directional smoothing. We agree with the reviewer that it can be confusing, we thus removed the panel E from the figure in the revised version of the manuscript.
R3.5. Discussion- <br /> The requested revisions in the data presentation will require revision of comparisons to other fMRI papers. <br /> The Discussion would be improved by a more extensive comparison to studies in monkeys where most of the mapping of M1 has occurred. An excellent brief summary of the monkey literature may be found in the section written by Paul Cheney in Omrani et al, 2017. The discussion should address two issues. <br /> First, a comparison of the organization of human M1 to the anatomical and physiological explorations of this region in the monkey. Second, the issue of specialization (separate regions of grasping and retraction) has its basis in monkey data that indicates specialization of M1 neurons for specific tasks.
We agree with the reviewer that the summary from Cheney provides a nice summary about representations in the motor cortex learned from monkey experiments. Based on this summary, we included an additional paragraph into the discussion section that should address the two issues.
Most of the knowledge on the functional representation of movements in the primary motor cortex has been obtained from countless experiments in monkeys over the last century. The current state of consensus in the field is nicely summarized by Paul Cheney in (Omrani 2017; see also referenced therein); Overall, corticomotoneuronal cells in the primary motor encode muscle-related parameters of movement such as muscle activity and muscle force. Although some corticomotoneuronal cells in the primary motor cortex (particularly those involved with finger movements) have their terminations confined to motoneurons of single muscles, a large amount of corticomotoneuronal cells are not rigidly coupled to the activity of its target muscles but show specialization for particular movements or categories of muscle activity. Namely, almost half of the corticomotoneuronal cells facilitate muscles involving at least one distal and one proximal joint and are specialized for specific muscle synergies, E.g. for reach-to-grasp movements. With respect to action representations shown in Fig. 2B, it is important to note that Cheney and Fetz (1985) had previously identified the muscle fields of neighboring corticomotoneuronal cells. They showed that neighboring corticomotoneuronal had muscle fields that were very similar. Hence, the notion of cortical patches that are preferentially activated for grasping and retraction actions (Fig. 2B) has its basis in previous monkey data and could refer to these previously described muscle fields.
Specific Comments:
R3.6. The first sentence of the Significance statement is incomprehensible. In general, the significance of this study is not well explained.
Since the significance statement is removed from the revised version of the manuscript.
R3.7. Introduction- Sanes et al., 1995 did not study monkeys.
We agree with the reviewer. The Sanes reference is moved to a different section now.
R3.8. "However, the organizational principle of smaller body parts such as individual digits could not be resolved due to the lack of localization specificity of conventional GE-BOLD fMRI and the sparse sampling of invasive electrophysiological recordings." This may be true for fMRI but the electrophysiological stimulation in monkeys (Kwan et al.l 1978; Strick and Preston, 1982 [up to 16 penetrations per 1mm2]) and Park et al. 2001) can hardly be described as sparse.
We agree with the reviewer that the term “sparse” might be misleading and does not give those experiments’ justice. The point we were trying to make is, that fMRI is inherently a continuous mapping technique that continuously samples the entire cortical sheath without any holes between electrodes. Which is true even at low resolutions. To address the reviewers comment, we revised the paragraph in the introduction section.
R3.9. Lin et al 2011 is often used as evidence that VASO accurately measures CBV. However, close examination of Fig. 1 in Lin et al reveals that the VASO and Gd-DTPA blood volume measurements often do not occupy the same voxels. That is, many VASO voxels with significant activation have no significant Gd-DTPA activation and many Gd-DTPA voxels with significant activation have no VASO activation. This observation suggests that VASO does not accurately represent CBV when voxel to voxel comparisons are made by the two different methods of measuring CBV. What other evidence, other than theoretical, indicates that VASO accurately measures CBV? (Lin AL, Lu H, Fox PT, Duong TQ. Cerebral blood volume measurements- Gd-DTPA vs. VASO - and their relationship with cerebral blood flow in activated human visual cortex. Open Neuroimag. J. 2011; 5: 90-95.)
We share the reviewer’s concerns whether VASO is a good measure for CBV. For this reason, we validated our SS-SI-VASO variant with gold-standard methods in multiple setups across the last 5 years. Ranging from concomitant VASO imaging with optical imaging spectroscopy in rats, up to validations of layer-dependent VASO signal with MION/Ferraheme imaging in rats and monkeys.
While we agree that Fig. 1 in Lin et al., shows deviations of VASO and Gd-DTPA, we would like to refrain from speculating what might be the reason for this. Reasons could range from acquisition challenges up to analysis inconsistencies. See the following reference:
Huber, L., et al (2015). Micro- and macrovascular contributions to layer-dependent blood blood volume fMRI: A multi-modal, multi-species comparison. ISMRM. doi: http://dx.doi.org/10.7490/f... ).
Note that our validation studies are quantitative in physical units of ml. This is in contrast to significance maps in Lin et al., that might be prone to biases in different noise characteristics post-injection of GD. <br /> Also note that our validations are carried out across columnar structures (B) and laminar structures (C).
See figures from:<br /> Huber, L., Goense, J.B.M., Kennerley, A.J., Guidi, M., Trampel, R., Turner, R., and Möller, H.E. (2015). Micro- and macrovascular contributions to layer-dependent blood blood volume fMRI: A multi-modal, multi-species comparison. In Proceedings of the International Society of Magnetic Resonance in Medicine, p. 2114. Doi: http://dx.doi.org/10.7490/f...<br /> Huber, L., Goense, J.B.M., Kennerley, A.J., Trampel, R., Guidi, M., Ivanov, D., Gauthier, C.J., Turner, R., Möller, H.E., Reimer, E., et al. (2015). Cortical lamina-dependent blood volume changes in human brain at 7T. Neuroimage 107, 23–33.<br /> Huber, L. (2015). Mapping human brain activity by functional magnetic resonance imaging of blood volume. University of Leipzig. https://fim.nimh.nih.gov/fi... <br /> Kennerley, A.J., Huber, L., Mildner, T., Mayhew, J.E., Turner, R., Möller, H.E., and Berwick, J. (2013). Does VASO contrast really allow measurement of CBV at high field (7 T)? An in-vivo quantification using concurrent optical imaging spectroscopy. In Proceedings of the International Society of Magnetic Resonance in Medicine, p. 0757.
In the revised version of the manuscript, we included the following additional paragraph into the discussion section:
Note that the CBV weighting in VASO has been extensively validated by comparisons with gold-standard methods in rats and monkeys across layer and columns (Huber et al., 2015a-c; Kennerley et al., 2013).
R3.10. The voxel size is listed as 0.89mm x 0.99mm on page 2 versus 0.79mmx0.79mmx 0.99mm on page 1. Which is correct?
The correction resolution is 0.79 mm. This typo is corrected in the revised version of the manuscript.
R3.11. Was the smoothing across layers a directional smoothing?
The reviewer is correct. The layer-smoothing was applied in specific directions only. It was only applied in the direction that is parallel to the column. There was no smoothing perpendicular to this direction. <br /> Note that this way of “directional” smoothing refers to cortical directions. The smoothing was independent of the direction in the laboratory frame of reference. As such, the smoothing is applied independent of the orientation of read-direction, slice-direction and phase direction. The LAYNII program LN_DIRECT_SMOOTH was not applied in this study. <br /> An additional sentence about this is included in the revised version of the manuscript.
R3.12. Page 13- "...primary motor cortex is 4 mm (Fischl and Dale 2000), the resolution of 0.79 mm used here allows us to obtain 5-7 independent data points across the 20 layers. The number of 20 layers is chosen based on previous experience in finding a compromise". This description is hard to understand. Suggest something like- The cortical thickness of the primary motor cortex is 4 mm (Fischl and Dale 2000). With our resolution of 0.79 mm, we obtained 5-7 independent data points across the thickness of the cortex. These data points were upsampled to create 20 layers across the thickness of the cortex. Twenty layers was chosen based on previous experience in finding a compromise... These 20 layers were smoothed and extracted (tell me what you did here) in sheets to produce a reconstruction of the face of the anterior bank of the central sulcus (Figs. 3S, 6S, 10S).
Based on the reviewer’s suggestion, we tried provide a more detailed description of the underlying assumptions and the necessity of using so many layers in a recent blog post: https://layerfmri.com/2019/... <br /> In the revised version of the manuscript, we the included the following summarizing statement:
The cortical thickness of the primary motor cortex is 4 mm (Fischl and Dale 2000). With our resolution of 0.79 mm, we obtained 5-7 independent data points across the thickness of the cortex. Across these data points, we created 20 layers across the thickness of the cortex on a 4-fold finer grid than the effective resolution. The number of twenty layers was chosen based on previous experience in finding a compromise data size and smoothness (see Fig. S6 in (Huber 2018)). Columnar profiles in Fig. 3 and Fig. S4 are generated from unsmoothed data. For Figs. S3 and S6, the functional signal was smoothed with 0.5 mm within columns and extracted in sheets to produce a reconstruction of the face of the anterior bank of the central sulcus. No smoothing was applied across columns.
R3.13. Fig. 2B- For participant 5, the copper and turquoise outlines are reversed. Hue of copper and turquoise colors are not consistent in each panel. <br /> In last panel of 2B, first line- there is a hand in this panel. What is its purpose? If the purpose is to be a key for finger color, the thumb should be magenta.
The reviewer is right, the copper and turquoise patch seems reversed in participant 5. Note, however that this is not a presentation error in the preparation of the images. We find that the grasping-extension patches do not follow a the same organization principle along the medial-lateral direction across participants. It is highly dependent on the position of the axial projection chosen. E.g. it can be seen in Fig. S6 (and previous version of Fig. S9) that, dependent on the depth of the central sulcus, the copper and turquoise patches are either on the medial or lateral side. Please also note that participant 5 is not an outlier here; in fact, participant 1 (in the same figure) has the same copper-turquoise alignment as participant 5. Please also note, that the sensory cortex consistently shows a grasping preference, across all participants.
The additional hand pictogram had been included as a figure key to remind the reader, which color refers to which finger. Based in the reviewers comments, it is excluded in the revised version of the manuscript. It is already shown in panel A) anyway.
R3.14. Fig. S3C- Several features of this figure make it hard to decipher and undermine the explanation of the reconstruction method. I am assuming that the little squares in panel B are equivalent to columns. This should be stated explicitly. If the colors correspond to the fingers, then the mirror representation of the hand shown in Figs. 1-3 is nowhere to be found. This is confounding. It may be useful to show the location of the slice in panel D. Panel D is reversed from panel A, creating needless confusion. In panel C, the laminar thickness of the cortex is greater than the depth of the central sulcus. Calibrations would help but why not make the laminar thickness accurate? State explicitly that the IMAGIRO reconstruction consists of 20 layers, each like the one in B. Spelling- Columnar 'distance' <br /> It took me a long time to understand what you were doing. The descriptions of the reconstruction needs to be simple, clear and intuitive or very few will comprehend them. It all makes sense but the reader should not have to go to the blog (which I did) to understand them.
We thank the reviewer for the suggestions to make this figure clearer. We also applaud the reviewers level of commitment to check the description on our blog.<br /> -> The little squares indeed refer to the columnar dimension. Additional comments are included in the caption.<br /> -> The colors do not refer to finger dominance, but to the medial-lateral position. This is included in the caption now.<br /> -> The location colors are now included in panel C, as suggested.<br /> -> Panels C and D are now switched, as suggested.<br /> -> If, the laminar thickness could be accurately depicted, all 20 layers would be 2-3 mm apart in the figure. If we would depict it in the right geometry, the layers could not be separated with the naked eye. Scale bars are included as suggested, which points out how they are distorted.<br /> -> An explicit reference about 20 layers is included.<br /> -> The typo is corrected in “distance”
Updated Fig. 3:
We agree, that an intuitive image is helpful. Here, we tried to find a compromise of simple intuitive figures that are representing the complexity of the analysis without making the supplementary material too long. The reviewer’s comments are appreciated to achieve this.
R3.15. Fig. 4S part B- Should note that this is upsampled to produce 20 layers.
The revised version of the manuscript has an additional statement included:
Note that the size of layer and column structures are smaller than the effective resolution of 0.79 mm. They are estimated in an upscaled space.
R3.16. Fig. 9S- Why is the background of the VASO view of the anterior bank of the CS entirely red? This implies that the entire CS is related to the 5th finger. How is that possible? Why are there yellow and green patches distributed all along the CS? This arrangement is different from any of the other figures. There does not seem to be a double mirror representation in this participant. <br /> In the bottom panels, why is the view limited to just part of M1 instead of the whole of M1? In general, this figure is quite confusing and really difficult to interpret. The organization of the grasping and retraction patches is an important issue. A better explanation (illustration?) of what you are trying convey in this figure is necessary.
We agree with the reviewer that previous Figure S9 could be confusing. We tried to show too many features in one Figure. Our goal of this figure was to show the consistency of the finger representations across the different tasks and also to show the position of the mirrored representation along the depth of the central sulcus. Based on the reviewer’s comments, we decided to remove Fig. S9. From the manuscript. We believe that these to messages already come across from Fig. S5, S6, S9 (new).
To answer the reviewer’s questions (for the sake of his/her curiosity): <br /> -> The top-right figure was included for the sake of orientation. It was not included to suggest the significance of the mirrored pattern. Thus, we did not threshold the finger dominances at all. In areas outside the hand-knob, therefore, the finger-preference measure for all fingers is close to 0. The red color outside the hand knob does not mean that this finger is represented there. It only means that all the other fingers are even noisier. E.g. that the finger preference for the index finger is 0.0014 compared to other fingers with a finger preference of 0.0005. For reference, in the hand knob, the finger preferences are in the regime 0.3-1 (please, see Fig. 3B about the absolute selectivity strengths in an outside the hand knob). The previous figure S9 corresponds to the line graph in Fig. 3B from above. <br /> -> We believe that there is, in fact, a mirrored pattern visible in this figure. Within the Brodman area subsection BA4A, the color pattern is reversed.
R3.17. Fig. 10S- in the right panel, the orientation seems to be incorrect. That is, left is lateral and right is medial which means the left ear arrow should be pointing to the right.
We agree, the arrow description now says “right” ear.
R3.18. I suggest alphabetizing the reference list.
In the updated reference list “S” is after “O”.
R3.19. The correct citation is- Meier JD, Aflalo TN, Kastner S, Graziano MS. Complex organization of human primary motor cortex: a high-resolution fMRI study. J Neurophysiol. 2008 Oct;100(4):1800-12. doi: 10.1152/jn.90531.2008. Epub 2008 Aug 6
The reference is updated.
On 2019-11-21 07:33:52, user Saravanan vijayakumar wrote:
Though the authors created "Consensus_NR" from the previous data set for this study, the authors should clearly state what is "Positive" and what is "Negative" data set. This is because, for instance (on random check) IEDB ID 107354, which is classified as "POSITIVE" in the "Consensus_NR" data set is reported to have 10 B-cell assays in IEDB, out of which 8 are negative 1 is positive and 1 is low-positive. Does this data should be in Negative? Similarly, IEDB ID 93172 which is also classified as "POSITIVE" in this study, but the IEDB reports 4 B-cell assay out of which 2 are negative and 2 are positive-low! Hence, authors should clearly mention what is "POSITIVE" and what is "NEGATIVE" according to this study. Also, it will be great if authors provide the sequences of both positive and negative data set they used in this study as supplementary, rather than only IEDB ids, because IEDB doesn't allow bulk epitope download via IDs.
On 2021-02-25 03:55:18, user Colin Dunstan wrote:
This is an interesting and insightful manuscript advancing the technologies available for in vitro developmental patterning of human stem cells with promise for 3D fabrication of human tissues accomplished via rational design of architecture, mechanical properties and composition of a 3D printed matrix scaffold.
On 2019-12-01 01:30:49, user DeboraMarks wrote:
No surprise that our lab likes this work - ha ha but seriously it says something about power of evolutionary information, deep generative models -and - oh - the ”un-supervision” keeping us honest on training/test that’s so hard with biological data. Now let’s do that for design
On 2020-03-03 15:20:54, user Sebastien LEON wrote:
Very interesting. Do you guys have any idea of how "strong" is the energy depletion caused by 2DG + antimycin? In terms of ATP levels, kinase activation etc.
On 2025-10-07 06:57:42, user Stéphane Mazières wrote:
The fetomaternal incompatibility between Neanderthals and H. sapiens is a very original hypothesis brought from "novel" genetic markers in the era of genomics: red cell polymorphisms. We have previously raised it in 2021 in our study of red cell blood groups (PMID: 34320013, not cited in the preprint)<br /> I have few more methodological concerns about this preprint: <br /> - the study does not precise which Neanderthal genome(s) has been studied and how the authors have identified the p.Gly307Ser.<br /> - all 3 high-quality Neandertal genomes have several other. missense polymorphisms in the PIEOZ1 exons. I don't understand why the authors have focused only on the p.Gly307Ser.<br /> - By the way, Denisova also carries the p.Gly307Ser.
On 2020-06-14 14:26:36, user Neeta Tanna wrote:
There is no supplementary materials
On 2017-10-25 15:57:00, user René L. Warren wrote:
ARCS has now been peer-reviewed:
Abstract:<br /> https://urldefense.proofpoi...
Article (free access):<br /> https://urldefense.proofpoi...
These are persistent URLs.
On 2017-03-16 22:33:41, user jstitlow wrote:
This probe synthesis technique worked well for us. Quality of the smFISH signal with these probes is comparable to commercial systems. Josh Titlow- Davis Lab, Oxford
On 2016-06-08 22:21:54, user John Urban wrote:
Oh - I may have found the commands and such in the supplement.
On 2017-12-15 13:07:47, user Tom Wallis wrote:
This paper presents an investigation of the relationship between voluntary attention and illusory contour perception using a novel stimulus and the classification image technique. The paper is interesting and well-written; I have some minor comments.
I’m not convinced by line 176. The effect itself is pretty weak / small, and to show that a weak effect disappears is maybe not surprising. Do the BFs at least show evidence supporting no difference?
I think the red line showing the illusory edge row is confusing - I initially mistook it for the area of pixels you were in fact testing, which of course didn’t make sense. I think it would be better to have something below the edge, spanning the illusory portion.
Line 197: The authors hypothesise that the illusory star form constrains voluntary interpolation of the illusory triangle edge. They could presumably test this by measuring classification images after rotating the non-target pacmen by 90 degrees (breaking the star but largely preserving local contrast). I think this condition would actually be useful as a baseline for the plots in Figure 2b: how strong could we expect the middle of the contour to be in the absence of the illusory star? For example, the authors could state something like “the presence of the competing illusory form reduces the strength of the illusory contour by 3-fold”. Is there any other data that could speak to this - perhaps Jason Gold’s work?
what exactly does the SVM fitting add? The pictures are nice to explicitly show the result of two / three potential hypotheses for how to do the task, but then these are not directly tested against the data. Rather it’s left up to the readers’ impression of the classification images and their correspondence to the three models (which is admittedly much more than most classification image studies do). While I do think it’s nice to have those hypothesis images generated from understandable models, I also wonder what value that’s added beyond just sketching those hypotheses by hand. Can the authors think of a way to test those hypotheses against the data more formally?
On 2020-03-21 14:37:39, user Peter Ellis wrote:
Hi,
In relation to our model of mtDNA partitioning between sperm (your ref 36), we fully accept that some kind of autosomal "permission" factor is likely to be necessary to allow paternal transmission of mitochondria.
Our argument was that any such factor is not sufficient to explain the observed quasi-Mendelian inheritance, and that there must in addition be some kind of competitive proliferation dynamics that leads to the production of two different classes of sperm bearing a single mtDNA haplotype each. I'm absolutely thrilled to see that your single cell analysis bears this out and provides evidence that a significant fraction of sperm are indeed homoplasmic for either the maternal or paternal mtDNA haplotype.
Peter
On 2021-03-17 03:18:46, user Sam Kariuki wrote:
CORRECTION on last sentence in abstract:<br /> The high rate of multidrug-resistant H58 S. Typhi, and the close phylogenetic relationships between carriers and controls, provides evidence for the role of carriers as a reservoir for the community spread of typhoid in this setting.
Should read:<br /> The high rate of multidrug-resistant H58 S. Typhi, and the close phylogenetic relationships between cases and carriers, provides evidence for the role of carriers as a reservoir for the community spread of typhoid in this setting.
On 2020-12-17 08:04:10, user Joerg Schneider wrote:
Can you please point me to or post supplemental material referred to in the text? (supplemental Table 1, supplemental information 1, supplement information 2). Thank you.
On 2022-06-13 08:08:35, user Olivier Gandrillon wrote:
This is a quite provocative view of the absence of cell types that could be identified through specific gene expression patterns in single-cell RNAseq data. My first comment is that Waddington was not the first one to propose the existence of distinct cell types, harbouring different functions. My second comment is more of a question: when you are using differentially expressed genes why do you still find no cluster structure? This seems weird to me. By definition of DE genes, they should define clusters. I fully agree that there should be some continuity in between cell types but at the same time tehre should be differences in between cell types.
On 2024-12-02 09:30:09, user Rebecca McDougal wrote:
This has now been published: https://doi.org/10.1186/s42483-024-00255-8
On 2016-06-23 18:22:45, user Yoav Gilad wrote:
I am not sure that the conclusions of this study are warranted. I wonder if the authors can comment on the following possible concern:
If I understand correctly, empirical normalization was performed, namely the same amount of RNA was labeled and hybridized to the array, regardless of time after death. If so, this means that genes that decay at a lower rate than the mean decay (or degradation) rates, will seem as highly expressed. This pattern is not expected to be linear, as it relates to the relationship between the decay rate of a specific gene and the overall decay of the entire sample (either of which is not necessarily linear). In addition to this issue, I could not find an explicit mention of modeling the RINs of the samples, or global analytical normalization of the data (did I miss it?). If this is indeed the case, the effects of the empirical normalization are confounded with differences in RNA quality across sample; this would make it even harder to predict what proportion of genes are expected to be 'seen' as highly expressed after death because of technical considerations alone.
On 2020-05-11 13:27:48, user Liz Miller wrote:
This paper was the subject of the Miller lab journal club and, following a fun discussion of the findings, we have the following comments to make.
In this paper, Clancy and colleagues confirm that the de-ubiquitylase enzyme USP9X regulates the stability of the RING E3 ligase ZNF598. They also establish an additional RING E3 ligase, MKRN2, as a new substrate of USP9X. Further, the authors identify a high specificity inhibitor of USP9X, and proteomics analysis confirms ZNF598 and MKRN2 to be amongst the proteins that are destabilised in response to inhibition of USP9X activity. MKRN2 and ZNF598 both play key roles in stalling and resolution of di-ribosomes, and consequently loss of USP9X activity, either through knock out or inhibition, impairs the cells’ ability to respond to ribosome stalling sequences.
Whilst USP9X inhibition is unlikely to be a useful pharmaceutical target due to its broad and important roles in various cellular processes, the identification of the highly selective inhibitor FT709 provides a useful tool for future studies into USP9X and its role in the regulation of ribosome stalling.
USP9X is implicated in ribosome stalling through its stabilising activity on ZNF598. We would be interested to know if this activity is dynamically regulated, such that it is increased in scenarios when ribosome stalling is more prevalent. For example, would its stabilising effect on ZNF598 increase above basal level if ribosome stalls were acutely induced by low doses of emetine (such as used by Juszkiewicz et al, 2018)?
We discussed the interesting problem of how USP9X might achieve specificity to ZNF598 and MKNR2 when there are other important ubiquitination events taking place at the ribosome (on 40S subunits and nascent polypeptide chain). The authors address that it is difficult to tease out these separate events, and this will certainly be an interesting area for future work.
Overall, we enjoyed reading this concise and clear story, and thank you for sharing your work on BioRXiv. We hope our comments are of some interest to the community.
On 2025-09-01 08:12:19, user Stefan wrote:
We thank the authors for their comment on our paper, however, we feel that some of the key take home messages have been misunderstood, and we wanted to provide some clarification.
“Recent work proposed that APOBEC-signature mutations in MPXV are enriched in cruciform structures formed by inverted repeats”
We never actually explicitly make the claim that the SNPs in question are ‘enriched’ within inverted repeats, as this was not the intent of the manuscript. Neither do we explicitly claim that these mutations are driven by APOBEC, and we agree that experimental evidence is necessary. We only state that ‘X’ number of SNPs fall within or near sequences with the potential to form IRs in the 2018 isolate.
The main point of interest and where the mutation hypothesis arose was when this earlier strain (2018) was compared to newer strains. Here we found that the newer strains shared far fewer of the SNP-associated IR sequences identified in the 2018 strain. Most of the IRs that were ‘lost’ more frequently were those that the SNPs fell within, and not the ones where SNPs were ‘near’ to. Which suggested to us that mutations were arising in these regions more frequently. This also made sense based on observations in other organisms. Moreover, the previous bias of including those near to would not have skewed the overall observations as most of these IRs were retained in the new strains.
The APOBEC hypothesis itself was based on previous observations by Isidro et al which formed the rationale for this study. They propose that the SNPs might be due to APOBEC mutations, and we were only trying to provide an observation that might support their hypothesis. Our mentioning of APOBEC was only to give our study some logical context. We agree that experimental evidence is absolutely critical to confirm these observations and apologise if we have misinterpreted the biological outcomes.
Hopefully this has provided some clarification for our study.
Best,
The Authors
On 2020-08-17 07:54:36, user Andrea Zaliani wrote:
Sirs<br /> I have problem with your definition of synergy. HSA should be positive for synergy and should use the max activity of single components alone, not the minimum. At least so, is here described https://bpspubs.onlinelibra....<br /> Am I wrong?<br /> Best<br /> Andrea Zaliani
On 2018-09-22 12:01:14, user Peter Andolfatto wrote:
The paper is similar to the Multiplexed Shotgun Genotyping paper of Andolfatto et al. 2011 https://www.ncbi.nlm.nih.go... . The latter uses an HMM to assign posterior probabilities of ancestry for each individual and imputes missing data.
On 2021-06-09 19:31:12, user Eden Tefera wrote:
Hello, Dr.Tian. My name is Eden Tefera and I am a current undergraduate student at UCLA in the Biomedical Research Minor. I wanted to thank you for your work in this paper as our journal club really appreciated the opportunity to read and learn from it. As we were reading there were some comments and suggestions that I would like to offer!<br /> Our comments have been detailed through your paper, but I wanted to reiterate the question about the timing of Mask OE. To avoid any developmental side effects, we suggest that Mask Overexpression occurs after the flies have grown up to avoid any complications. Doing this may also elucidate what exactly the flies are dying of that Mask circumvents. <br /> In reference to Figure 2, we were wondering what the downstream effects of upregulating GPCR signaling in DANs are. Additionally, a graph comparing the lifespan extension due to upregulating GPCRs vs Mask overexpression could be helpful in showing the importance of Mask to this system. It’s possible that Mask OE is restructuring the Dopaminergic system, maybe creating a separate pathway through which lifespan extension is facilitated. <br /> In reference to Figure 7, we suggest using a bar graph to visualize the data rather than survivorship curves. Switching to a bar graph could make the increases/decreases in lifespan in each experimental condition more clear. <br /> This was a fascinating paper to read and thank you again for the opportunity to read your science!
On 2024-12-01 16:53:12, user Clement Kent wrote:
Interesting work which advances the field. <br /> Just recording a few typos here. <br /> Line 103 refers to Allan(19) but no such item in the references.<br /> Line 8,16,18 - author Erclik listed with 2 identical affiliations.<br /> Line 188- put in the reference number. <br /> Lines 214 and 257 - tup is the Flybase standard name for this gene. I don't see why you insist on Islet. At any rate, italicize tup in 214.<br /> Line 393: optogenetically instead of optogenetic.<br /> Line 447: "for each of 32 hemilineages"<br /> Line 628 " obtained from"<br /> Lines 833,894,967 - update references
On 2023-02-25 01:22:56, user Kostas Tsirigos wrote:
It's interesting to see that papers publishing topology prediction methods in 2023 only compare themselves to one (1) method (!) and, of all methods, this is TMHMM (published in 2001). You could at least compare to DeepTMHMM, that has replaced it.
Not sure how that signifies any progress in the field of TM topology prediction methods.
Also, where are the training data? Could not see them on Github. These should be made available to the community.
On 2025-10-21 05:01:38, user Beatrice Opoku wrote:
This study by Bento et. al (2024) revealed that both Anopheles mosquitoes and plasmodium parasites are influenced by rhythms that have evolved to synchronize in order to optimize infection and transmission timing within the hole. Researchers asked whether the biological clocks helped the organism anticipate blood meals and modulate, parasite behavior, which would ultimately affect malaria transmission. There are three primary findings in this paper. The first finding was that roughly half of the mosquito salivary gland transcriptome exhibit 24 hour rhythmic expression. The expression peaks occurred twice daily once early in the day and once early in the night, which alliance with the gnome mosquito feeding patterns. These changes persist in both light/dark (LD) and constant darkness (DD) conditions. This was an indication that the genes in the salivary glands were driven by an internal circadian clock rather than by light cues or environmental factors. The second finding is that the Plasmodium sporozoite in the salivary gland also show cyclic transcription, that included cells involved in motility and host cell invasion. The authors ruled out the possibility that the observed rhythmic expression could be due to changes in sporozoite numbers due to replication or migration. After using immunofluorescence to visualize sporozoites at specific time points and testing for DNA replication, they found no evidence that replication explained the cyclic patterns. These results strengthened to idea that both mosquito and parasite are synchronized by daily cycles. Lastly, the found that mosquitoes are more likely feed at night and ingest more blood. Mice infected with sporozoites at night show higher liver parasites loads than mice infected during the day, indicating that sporozoites more infective at night. Together, these results suggest that the mammalian host, Plasmodium parasite and the Anopheles mosquito have evolved coordinated daily rhythms that maximize transmission success.<br /> The paper’s central contribution is the discovery that both the Anopheles mosquito vector and the Plasmodium parasite operate under circadian control and that their biological rhythms are synchronized to optimize malaria transmission. <br /> A critique that I would give to the main contribution is that experiments use Anopheles mosquitoes and Plasmodium berghei (a rodent malaria model). While appropriate for a controlled lab setting, it does not fully represent human malaria species or the natural mosquito environment. Conducting similar experiment in the future on human malaria parasites and field collected mosquitoes would strength relevance to the human population. <br /> If I were to write the significance of the paper on a 1-5 scale, I would give it a 4. It provides an important discovery with clear implication for control strategies. <br /> Overall, the methodology is mostly convincing. The researchers sampling every 4 hours, replication cross LD and DD conditions and combined transcriptomic and proteomic approaches provide a strong support for the presence of rhythmic gene expression. However, I have some questions about the results. The paper shows differences in expression levels between LD and DD conditions. What explains the discrepancies. This study would benefit from more discussion or experiments that addressed the source of LD and DD differences. Also, not all genes within the sporozoite showed clean cyclic patterns. For example, p52, CS, and AMA-1, displayed irregular or weak oscillations. It would be helpful if the authors addressed whether their irregulars reflect true biological variability or something external among the sporozoites. Also, a direct manipulation of clock components would strength the link between salivary gland genes and sporozoites. <br /> The most important limitation is generalizability. This study’s experiments focused on rodent-parasite/mosquito system under controlled conditions. This makes it unclear whether the observed data of rhythmic gene expression operates identically in natural setting with human malaria species and diverse mosquito environments. <br /> I would rate the writing 3/5 for clarity. The method’s section was dense and difficult to follow in some parts. There were technical terms and procedural details that were not fully explained for a non-specialist reader. For example. algorithms were named (e.g., ARSER, JTK_CYCLE), but a brief, plain-language description of what each contributes would help readers unfamiliar with circadian statistics. Also, some of the figures lacked proper labeling so it as hard to interpret what the data without having to refer back to the paper. However, the abstract, introduction, results and discussion were readable and logically organized. <br /> Overall, the paper reframes malaria as a time-dependent system in which the vector, parasite and host rhythms are important for infection and transmission. Practical implication includes creating strategies that uses this knowledge such as insecticide spraying, bed-net use or prophylactic drug delivery to disrupt transmission timing. Moreover, this study can extend to other vector-borne disease such as Zika and dengue. Ultimately, this research contributes to the growing appreciation that temporal organization is central to biological function.
On 2017-09-16 16:07:35, user R. Ahmad wrote:
I was curious about the same thing. It seems like there should be a difference in total reads since you’d start with half the material. Although since they are blastomeres, you’d have to amplify for sequencing, and illumina uses additional amplification. There is the possibility for bias in that case. That’s probably why allele dropout has been such an issue. Science put this out in their blog, “This possibility of “allele dropout” has been the subject of discussion in the field ever since the Nature paper was published, says developmental biologist Robin Lovell-Badge of the Francis Crick Institute in London. Many scientists are now waiting for a response from Mitalipov, he says.”
On 2020-03-17 17:09:13, user Bryan J. Gonzalez wrote:
Amazing work and exciting findings about relationship of cell cycle progression and beta-cell differentiation. This is approach is very helpful to improve differentiation protocols and prevent teratomas when grafting.
On 2024-12-06 20:40:30, user Laurie Ailles wrote:
A more recent version of this article has now been published in Nature Communications: Nat Commun. 2024 Sep 19;15(1):8232. doi: 10.1038/s41467-024-52507-y
On 2019-06-06 01:36:12, user Joe Flood wrote:
Very irritating the way these authors insist on using ISOGG nomenclature for Y haplogroups, but can't be bothered keeping abreast of changes. 'R1b1a2' used for the Catacomb samples has at various times in the past been Z2103, M269, V88 and is now BY15383. My guess is they probably mean the Z2103 'Yamna' subclade'
On 2019-09-19 11:55:27, user yochannah wrote:
Hey y'all - nice preprint!
This popped up in my alerts as I'm one of the developers of InterMine, the software that PhytoMine is based on. I had a tiny improvement to suggest for the links you've included, e.g. https://phytozome.jgi.doe.g... - this format of link isn't necessarily permanent, so it's possible that in the future that link might not point where you'd expect it to.
The good news is that you _can_ get permanent links - just go to each page and look for the (admittedly rather tiny) "share" button on the top right. That will give a link that looks like this: https://phytozome.jgi.doe.g... rather than the original link, and it should remain up in the longer term. I hope that helps! :)
If you need any more help or advice, please contact support@intermine.org or the phytomine support line :)
On 2020-01-21 20:15:17, user Vincent Prevosto wrote:
A classic reference of interest here is Kuyper 1982's review. A quote:
The fibers to the dorsal horn apparently constitute the primordial component of the corticospinal tract, because they are present in all mammals. These fibers probably subserve a sensory control and in cat and monkey are mainly derived from the granular somatosensory cortex