1. Mar 2026
    1. On 2024-02-23 23:44:15, user Doris Loh wrote:

      The preprint stated that "taurine (TCI Chemicals) was dissolved directly into complete cell culture media at a concentration of 40 mg/mL", which is 319.62 mM. However, throughout the entire study, the only concentration of taurine used in various experiments was either 160 mM or 100 uM. Was 40 mg/mL a typo or did the authors use 320 mM instead of 160 mM?

    1. On 2018-09-20 00:12:06, user Arlin Stoltzfus wrote:

      Though this paper cites McCandlish and Stoltzfus 2014, a lengthy historical and mathematical review of origin-fixation dynamics, the contents of that paper clearly have not been digested. They explain the history and also the logical structure of derivations, and they raise the same questions about whether the assumptions of origin-fixation dynamics are actually justified for natural populations. Multiple things you say in the introduction are not justifiable, e.g., the "weak mutation" assumption underlying origin-fixation dynamics is not at all "classical," being completely divorced from the views of Fisher, Haldane and Wright. Origin-fixation dynamics are presented explicitly in two different papers in 1969.

    1. On 2020-08-19 12:37:40, user Tomáš Hluska wrote:

      Hi, if you have still chance to change the manuscript, here are a couple of things I noticed:<br /> - p. 7 at the very end sentence starting "Compared to wild type" contains twice the concentrations<br /> - p. 9 first line - should be Suppl. Fig. 4B<br /> - You don't use consistently the abbreviations. Mostly, you use LOT, but e.g. in Fig. 6 description you use KO.<br /> - Fig. 7 - what are the standard conditions? Are they the same for both transporters or do they differ? BTW in the text you say (and I would agree) that the Ade uptake decreases in absence of E source, while in the Fig description you say "its activity is independent of an energy source.". Yeah, it may be less affected but there is still some effect.<br /> p. 15 - may transports - should be may transport

      Honestly, I don't see much difference in the azg2 ko and AZG2 OE plants on 8-aza-Ade (Suppl. Fig. 4B).

    1. On 2017-04-11 09:52:55, user Yu-Chen Liu wrote:

      The authors appreciate the insightful feedbacks and agree with prospect that hypothesis derived from small RNA-seq data analysis deserve examination in skeptical views and further experimental validation. Regarding the skeptical view of Prof. Witwer on this issue, whether a specific sequence were indeed originate from plant can be validated through examining the 2’-O-methylation on their 3’ end (Chin, et al., 2016; Yu, et al., 2005). The threshold of potential copy per cell for plant miRNAs to affect human gene expression was also discussed in previous researches (Chin, et al., 2016; Zhang, et al., 2012).

      Some apparent misunderstandings are needed to be clarified:

      ? In the commentary of Prof. Witwer:<br /> “A cross-check of the source files and articles shows that the plasma data evaluated by Liu et al were from 198 plasma samples, not 410 as reported. Ninomiya et al sequenced six human plasma samples, six PBMC samples, and 11 cultured cell lines 19. Yuan et al sequenced 192 human plasma libraries (prepared from polymer-precipitated plasma particles). Each library was sequenced once, and then a second time to increase total reads.”

      Authors’ response:

      First of all, the statement "410 samples" within the article was meant to the amount of runs of small RNA-seq run conducted in the referred researches. Whether multiple NGS runs conducted on same plasma sample should be count as individual experiment replicates is debatable. The analysis of each small RNA-seq run was conduct independently. The authors appreciate the kind comments for the potential confusion that can be made in this issue.

      ? In the commentary of Prof. Witwer:

      “Strikingly, the putative MIR2910 sequence is not only a fragment of plant rRNA; it has a 100% coverage, 100% identity match in the human 18S rRNA (see NR_003286.2 in GenBank; Table 3). These matches of putative plant RNAs with human sequences are difficult to reconcile with the statement of Liu et al that BLAST of putative plant miRNAs "resulted in zero alignment hit", suggesting that perhaps a mistake was made, and that the BLAST procedure was performed incorrectly.”

      Authors’ response:

      The precursor sequences of the plant miRNAs, including the stem loop sequences (precursor sequences) were utilized in the BLAST sequence alignment in this work. The precursor sequence of peu-MIR2910, “UAGUUGGUGGAGCGAUUUGUCUGGUUAAUUCCGUUAACGAACGAGACCUCAGCCUGCUA” was used. The alignment was not performed merely with the mature sequence, “UAGUUGGUGGAGCGAUUUGUC”. <br /> The stem loop sequences, as well as the alignment of the sequences against the plant genomes, was taken into consideration by using miRDeep2 (Friedländer, et al., 2012). As illustrated in the provided figures, sequencing reads were mapped to the precursor sequences of MIR2910 and MIR2916. <br /> As listed in the table below, a lot of sequencing reads can be aligned to other regions within the precursor sequences except the sequencing reads aligned to mature sequences. For instance, in small RNA-seq data of DRR023286, 5369 reads were mapped to peu-MIR2910, and 4010 reads were mapped to the other regions in the precursor sequences.

      https://uploads.disquscdn.c...

      (Check the file MIR2910_in_DRR023286.pdf, MIR2910_in_SRR2105454.pdf, MIR2914_in_DRR023286 and MIR2916_in_SRR2105342.pdf) <br /> The pictures are available in the URL:

      <https: <a href="www.dropbox.com" title="www.dropbox.com">www.dropbox.com="" sh="" 9r7oiybju8g7wq2="" aadw0zkugsdsti3aa\_4x6r8ua?dl="0">

      As described in the article, all reported reads mapped onto the plant miRNA sequences were also mapped onto the five conserve plant genomes. Within the provided link a compressed folder file “miRNA_read.tar.gz” is available. Results of the analysis through miRDeep2, were summarized in these pdf files. Each figure file was named according to the summarized reads, sequence run and the mapped plant genome. For example, reads from the run SRR2105181 aligned onto both Zea mays genome and peu-MIR2910 precursor sequences are summarized in the figure file “SRR2105181_Zea_mays_peu-MIR2910.pdf”.

      ? In the commentary of Prof. Witwer:

      “Curiously, several sequences did not map to the species to which they were ascribed by the PMRD. Unfortunately, the PMRD could not be accessed directly during this study; however, other databases appear to provide access to its contents.”

      Authors’ response:

      All the stem loop sequences of plant miRNAs were acquired from the 2016 updated version of PMRD (Zhang, et al., 2010), which was not properly referred. The used data were provided in the previously mentioned URL.

      ? In the commentary of Prof. Witwer:

      “Counts were presented as reads per million mapped reads (rpm). In contrast, Liu et al appear to have reported total mapped reads in their data table. Yuan et al also set an expression cutoff of 32 rpm (log2 rpm of 5 or above). With an average 12.5 million reads per sample (the sum of the two runs per library), and, on average, about half of the sequences mapped, the 32 rpm cutoff would translate to around 200 total reads in the average sample as mapped by Liu et al.”

      Authors’ response:

      Regarding the concern of reads per million mapped reads (rpm) threshold, the author appreciate the kind remind of the need to normalize sequence reads count into the unit in reads per million mapped reads (rpm) for proper comparison between samples of different sequence depth. However the comparison was unfortunately not conducted in this work. Given the fact that the reads were mapped onto plant genome instead of human genome, the normalization would be rather pointless, considering the overall mapped putative plant reads only consist of ~3% of the overall reads. On the other hand, the general amount of cell free RNA present in plasma samples was meant to be generally lower than within cellar samples (Schwarzenbach, et al., 2011).

      Reference

      Chin, A.R., et al. Cross-kingdom inhibition of breast cancer growth by plant miR159. Cell research 2016;26(2):217-228.<br /> Friedländer, M.R., et al. miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. Nucleic acids research 2012;40(1):37-52.<br /> Schwarzenbach, H., Hoon, D.S. and Pantel, K. Cell-free nucleic acids as biomarkers in cancer patients. Nature Reviews Cancer 2011;11(6):426-437.<br /> Yu, B., et al. Methylation as a crucial step in plant microRNA biogenesis. Science 2005;307(5711):932-935.<br /> Zhang, L., et al. Exogenous plant MIR168a specifically targets mammalian LDLRAP1: evidence of cross-kingdom regulation by microRNA. Cell research 2012;22(1):107-126.<br /> Zhang, Z., et al. PMRD: plant microRNA database. Nucleic acids research 2010;38(suppl 1):D806-D813.

    1. On 2019-05-29 14:39:32, user Victoria wrote:

      I appreciate that the authors do acknowledge that the recombinant and native enzymes may possess different properties. This assumption is often underestimated, especially by biochemists with chemical background. Yet I would like to pinpoint that the statement of the manuscript that "The biochemical and enzymatic properties of the native KADHC in mammalian tissues have not been characterized", is not true. In 2017, a paper was published (PMID: 28601082), where it was shown that a rather high levels of OGDH activity in the brain homogenates are devoid of the OADH activity. That said, one cannot exclude formation of the hybrid complexes in the cell lysates as an artefact of the detergent extraction and/or further purification procedures. Regarding the OADH activity of the purified OGDH complexes, one could add other couple of references to the discussion: PMID: 10848975; PMID: 8495733

    1. On 2020-04-03 14:46:22, user Maria Llamazares wrote:

      It was a pleasure, a challenge and a very positive scientific experience collaborating with Big Pharma (Boehringer Ingelheim, our sponsors), Academia in Germany and US (EMBL, DKFZ, McGovern Medical School), clinics (Thorax Clinic Heidelberg, Asklepios Biobank) from our Innovation Center (BioMed X). Big thanks to all the authors for their excellent work and input!! Hope you can implement succesfully our workflow for the profiling of human samples!!!

    1. On 2018-08-31 05:31:31, user Harel Weinstein wrote:

      Glad to see the data in this preprint https://doi.org/10.1101/362970 . So many different ways have been suggested for membrane modulation of GPCR function, especially by stabilization of various states. Not much was said or cited about these in this manuscript, but the literature is there. Without energy calculations and appropriate comparisons, it must be difficult to discern the specific mechanism and the relative importance of the different modes of modulation by the membrane. Binding to a protein state is a competition with the surrounding membrane, and, if the composition changes, so will the apparent affinity of the binding lipid (Chol, Pip2, etc). Even if it still adheres, the stabilizing effect may be insignificant. How best to interpret this? We are still trying to decide what can be learned from the identity of lipids adhering to the protein in certain conditions and how the hydrophobic mismatch energy on the one hand, and the segregation free energy of the particular binding lipid, on the other, balances this. Any good ideas from the in-vivo-like membrane results about likely concentrations required of potential modulators? It's a fascinating problem but may be more complex than it appears.

    1. On 2019-12-30 14:59:49, user Lei Khiang Tswian wrote:

      It would be great if Japanese and Siberian samples are included in the Admixture analysis. The purple source in Mongolic and Tungusic populations cannot be the same as that of Sino-Tibetans. It should be splitted into at least three sources including Northern Asian (Siberian), Eastern Asian (Japanese) and Sino-Tibetan (such as Yi/Naxi).

    1. On 2020-05-13 19:27:51, user Sinai Immunol Review Project wrote:

      Keywords: SARS-CoV2, Human lungs, Transcriptomics

      Main findings: In this preprint, the authors used bulk and single-cell transcriptomics in human lungs to study possible interactions between age-associated host genetic factors and genes regulated by SARS-CoV-2/SARS-CoV infection. Their transcriptomics data suggest that an aging lung has an increased vascular smooth muscle contraction, reduced mitochondrial activity, and decreased lipid metabolism though expression of cellular receptors for SARS-CoV2 was not age dependent. Combining both bulk- and single-cell sequencing data, they found that the number of lung epithelial cells, macrophages, and Th1 cells decrease with age, while those of fibroblasts and pericytes increase with age. The authors speculate that these age related changes in tissue composition and cell interactions could potentially predispose the ageing lung to pathological contraction seen in COVID-19 infections. Authors suggest a larger overlap of genetic pathways between the aging lung and SARS-CoV-2 infection compared to younger population, making the elderly more susceptible to COVID-19 infection.

      Critical Analyses: <br /> 1. The study did not include samples from COVID-19 positive patients.<br /> 2. Aging is a complex multifaceted phenomenon, making clear deductions would be difficult and further studies for cross-validating these observations will be needed.

      Relevance: Since elderly populations are worse hit by SARS-CoV2 infections, it is of immense importance that we understand the underlying mechanisms of this increased vulnerability and accordingly develop rational therapies for COVID-19.

      Reviewed by Divya Jha, PhD and edited by Robert Samstein, MD PhD, as part of a project by students, postdocs and faculty at the Immunology Institute of the Icahn School of Medicine, Mount Sinai.

    1. On 2021-01-08 23:46:13, user Alejandro Marquez wrote:

      Hello, honestoy I don't get how these primers can be specific for the new variant, I only found SNP variations in the middle of the primer and not in the 3'-end. Based on my experience these primers will amplify with the original and the new variant... can you explaint better...?

    1. On 2017-05-27 01:36:11, user Davidski wrote:

      Hello authors,

      You refer to ancient populations from what is now Iran as Iranians and to potential admixture from such populations as Iranian ancestry.

      This is an anachronistic approach and probably not a good idea.

      Please note that Iran is a modern-day country, not a geographical region, and Iranians are a modern-day nationality, and at best the term Iranian can be extended to the speakers of Iranian languages.

      So it might be better to say the South Caspian region or even the Zagros Mountains instead of Iran. And instead of using Iranian it's probably more sensible to say something like Chalcolithic farmers from modern-day Iran or the Zagros range.

    1. On 2025-08-19 19:07:24, user Eric Miller wrote:

      The authors present interesting information showing that a KD could enhance glutamine uptake when glucose is reduced through KD thus suggesting that glutamine targeting would be effective for managing pancreatic cancer when employed together with KD therapy. Mukherjee et al. presented a similar therapeutic strategy but with an explanation for the therapeutic effect different from that of the author’s ( https://doi.org/10.1038/s42003-019-0455-x) "https://doi.org/10.1038/s42003-019-0455-x)") . It is important for the authors to address the different explanations for the similar findings in their discussion.

      Besides an anapleurotic explanation for the role of glutamine in driving tumor growth, the authors should also address a role for mitochondrial substrate level phosphorylation in the glutaminolysis pathway as an additional explanation for the effect ( https://doi.org/10.1080/17590914.2024.2422268) "https://doi.org/10.1080/17590914.2024.2422268)") .

      The authors assume that ketone bodies and fatty acids are critical fuel sources for pancreatic tumor cells based on their finding of labeled TCA metabolites derived from beta-hydroxybutyrate and caprylic acid. No evidence is presented showing that the pancreatic tumor cells can survive on these fuels in the absence of glucose and glutamine. Caution is needed in considering labeled TCA metabolites as evidence for fuel utilization in the absence of viability studies.

      Abnormalities in mitochondria structure and function are found in pancreatic cancer (https://doi. org/ 10. 3109/ 01913 123. 2013. 788306; https:// www. ncbi. nlm. nih. gov/ pubmed/ 6185201; https:// www. ncbi. nlm. nih. gov/ pubmed/ 968802). Such abnormalities would obstruct efficient utilization of fatty acids and ketone bodies for ATP synthesis. The authors must address the question of how ketone bodies and fatty acids can be critical fuel sources in pancreatic cancer showing abnormalities in mitochondria structure and function. Support for the author’s assumption would come from bioenergetic evidence showing that the MIA-PaCa2 cells die in hypoxia and cyanide, which would be expected for cells dependent on fatty acids & ketone bodies for fuel. No credible evidence is presented showing that the MIA-PaCa2 have normal mitochondrial function.

      The authors mention (reference 22) as an example of a "push-pulse" strategy, where a ketogenic diet nudges a system towards greater dependency on a specific metabolic program, which in turn exposes new dependencies. This paper is incorrectly cited as there is no mention of a "push-pulse" strategy in the paper. The correct terminology is “Press-Pulse and was first presented in the following paper, which is the correct citation (DOI 10.1186/s12986-017-0178-2).

    1. On 2019-07-25 07:38:15, user Guillaume Méric wrote:

      Thanks for your comments and interest in our work.

      1. We aren't really comparing the environmental datasets to one another, but it is good to see that this approach will classify more reads in samples generated differently.

      2,3,4,6. The study presented here showing a link between classification performance and the size/composition of indices was performed using GTDB release 86. We have also recently created an index based on the GTDB release 89 (https://github.com/rrwick/M... "https://github.com/rrwick/Metagenomics-Index-Correction)"). The number of MAGs in r89 is higher than in r86, which will contribute to an even better classification using r89.

      Regarding your other points: Rather than the classifier tool, the reason why the prokaryotic fraction of environmental metagenomes is still not fully classified even with corrected indices is indeed the general misrepresentation of non-clinical environmental sequences in public repositories. More generally, it is correct that fine-tuning specific taxa in context-specific databases to specific needs of a study (environment/host/etc) will improve future work, and our paper highlights this possibility. The more reference genomes from a particular environment/host (MAGs or not) that you will add to the index, the more reads you will classify from any metagenomic sample from that environment/host. Notwithstanding, our corrected indices classify up to 6 times more reads/samples in environmental samples as compared to default indices, which is a promising example. In the future, better and more accurate databases (built using MAGs or not) will of course improve this even more.

      1. This (perhaps) counter-intuitive result is explained in the manuscript at lines 181-186, and has also been previously reported in https://www.ncbi.nlm.nih.go....
    1. On 2020-10-14 10:01:24, user isthereanyhope wrote:

      Nice work! Does this mean V1 -> RSC visual input goes first to place cells and then to grid cells, given that gain manipulations in VR show place cell firing has greater influence of vision and grid cell firing greater influence of path integration (Chen et al., 2019, Nature Comms 10:630)?

    1. On 2020-07-28 14:54:58, user @MRI_phys_KS wrote:

      Thanks for this toolbox.

      I'm sure you know that the thresholded k-space division (TKD) methods of Shmueli et al., 2009 and Wharton et al., 2010 give different results. Which one have you implemented as method (1) in SEPIA's QSM panel?

      If you need an implementation of Shmueli's TKD you can find it here: https://xip.uclb.com/i/soft... along with a nice iterative Tikhonov regularisation method described in more detail here: https://pubmed.ncbi.nlm.nih...

    1. On 2021-10-21 14:07:25, user Iris Chen wrote:

      Great analysis and synthesis of ideas pertaining to the mechanism by which macrophages stimulate cancer cell proliferation. The findings are interesting and innovative, and the arrange of figures and conclusions is also great! And I am just a little bit confused with Figure2A, so why you chose to observe the recipient cancer cells for 15 hours? Because I find in some experiments, the data was collected after cells were co-cultured for 24 hours, so maybe you can also lengthen the observation time in 2A to 24 hours, in this way I think your conclusions will be better supported. And another possible advice is for Figure4D, I think here you can also add a figure to show the number of mito fragments with in the artifact macrophages, just like Figure4B. And I also think you could add more details in the introduction part, like the proliferation of breast cancer cells (why you chose to get the data after 24 hours), the relation of ROS and ERK (is there any previous studies about this pathway? are there other possible pathways?), and the mitochondrial network in macrophages (has anyone also found M2 with smaller mitochondrial fragments before? and does the mitochondrial phenotype influence the cell functions?). Anyway I think this is a really good preprint, thank you for presenting your work here.

    1. On 2016-06-15 16:11:21, user Dwight Read wrote:

      The local isotope ratios are determined as follows: "Archaeologists construct local reference ranges of strontium isotope ratios by sampling sediments, waters, plants, and/or animal bones/teeth (both archaeological and modern) in the geographic areas surrounding particular sites." What we also need to know is the geographic scale over which the local isotope ratio extends. How far from the community in question could someone be raised, then migrate to this community, and still have an isotope ratio comparable to the reference ratio used for classifying someone as a local? In other words, how rapidly, and to what extent, does the background isotope ratio change as one moves away from the community? How does this compare with the likely distance between neighboring communities?

    1. On 2014-08-09 19:44:19, user Jamie Cate wrote:

      To the authors,

      Interesting results, and thanks for posting. I forwarded the link to my group.

      An implication of your findings, correct me if I'm wrong, is that the translational efficiency of a specific mRNA should vary depending on the species of ribosome which is translating it. Further, there must be a mechanism that partitions more translationally active ribosomes from less active ribosomes on a given mRNA, for the ribosome species to be separated by polysome position. In other words, why would a specific mRNA equally present in the yeast trisome fraction and tetrasome fraction have different ribosome species bound? What are your thoughts on this?

      As a note of caution, in refs. 24-25, the authors were a bit concerned about the translational activity of lighter polysomes being relatively lower for artifactual reasons, i.e. monosome contamination, inactivation of oligomers, and ribosome dimerization in high magnesium ion concentrations (ref. 24, p. 636, left column). As an orthogonal measure, is there information embedded in some of the ribosome profiling data to address this? For example, do mRNAs with a higher translational efficiency (TE) have faster rates of translation as inferred from chase experiments with harringtonine?

      Jamie

    1. On 2017-08-24 16:12:11, user Leslie Vosshall wrote:

      Thank you for posting this preprint. The Vosshall lab read Vinauger, Lahondere et. al. for our lab journal club and wanted to share our collective thoughts below. Because of our expertise in neurogenetics, we focused on the genetic mutants below, followed by more general comments and questions about the rest of the paper.

      CRISPR Mutagenesis

      It is exciting to see a wider adoption of CRISPR-based mutagenesis in mosquitoes, part of the larger push to bring precise, targeted genetic manipulations to non-traditional model organisms with fascinating ethology and critically important public health relevance. Here, CRISPR is used to perform targeted mutagenesis of the Dop1 receptor (Dop1R1) in Ae. aegypti mosquitoes to explore the genetics of dopamine receptor signaling in host seeking behaviors, and represents an important complement to dsRNA and pharmacological approaches to support the conclusions of the paper.

      Co-injecting two (or more) sgRNAs is a potent mutagenesis strategy in many animals, including Ae. aegypti, and was used here to isolate an allele with an 18bp in-frame deletion relatively early in the open reading frame of Dop1R1.

      • Did these injections lead to additional distinct alleles from different founders? If so, what was the rationale for choosing the 18bp (6aa) in-frame deletion reported here for further study? If there were viability or other fitness effects noted in other lines predicted to be more destructive to the gene product, that is important to note (and an interesting finding in its own right!)

      • Can the authors say anything about whether this protein is expressed and trafficked at levels similar to wild-type? For example, could the authors stain Dop1 mutant brains with their anti-Dop1 antibody? If so, can they make any predictions or speculations on the function of the mutant receptor based on the location of the deletion in the predicted protein sequence? Is there evidence to suggest the allele is a hypomorph vs. a full loss-of-function?

      • We had some questions about genetic background. In addition to the potential for off-target mutations induced by CRISPR/Cas9, the Aedes aegypti genome is replete with recessive deleterious mutations and large regions of low recombination. Accordingly, inbreeding can cause fitness defects that manifest themselves non-specifically across a variety of behavioral assays (lower activation and overall activity, for example, as hinted at in the CRISPR data points in Figure S2). Overall, this makes the choice of outbreeding scheme and allelic combinations critical when using genetically modified mosquitoes in behavioral experiments. We are not sure if this is possible, but these concerns would be addressed if behavioral experiments were performed with a heteroallelic combination of independently isolated, outbred, and homozygosed alleles and compared to appropriate parental strain and heterozygous control genotypes. If this is not possible, then it would be great to see more independent validation of the fitness of this homozygous mutant line outside the context of learning. We have had some nightmare scenarios where homozygous mutants of orco (and other genes we have targeted) had intriguing behavioral problems that went away when we tested heteroallelic combinations. We think background effects confounded out initial results.

      • It was not clear from the text in the methods and the figure how outcrossing and homozygosing was performed, and these details should be clarified to note the number of generations that animals were outcrossed back to the wild-type (parental) strain as opposed to intercrosses between heterozygous mutant animals designed to generate a homozygous mutant line.

      • We had some questions about other aspects of Dop1R1 mutants. Do mutant animals lay the same number of eggs? Are their circadian rhythms unaltered? It would be nice to see them in the CO2 assay in Figure 3, as well as to have a more detailed description of their baseline activity in the CO2 and host-seeking behavioral assays when compared to the appropriate parental and heterozygous controls.

      Additional comments and questions

      1. We found the mosquito learning behavior shown here very interesting and are looking forward to further studies from the authors in the future.

      2. The ability of mosquitoes to selectively learn to avoid certain odor stimuli including 1-octen-3-ol and rat odor (but not chicken odor) is an interesting observation. We found it interesting that learned avoidance of the human odor blend was not as strong, since in Figure 1D there was no difference between unpaired and trained mosquitoes. It would be helpful to include the average percentages of mosquitoes attracted into each arm (in addition to preference index) within the main text.

      3. It would be interesting to see for at least some experiments the additional controls of odor (conditioned stimulus) and mechanical perturbation (unconditioned stimulus) alone to determine how these affect choice.

      4. The increase in frequency and amplitude in response to CO2 in the tethered flight arena is a neat result. We are wondering what the change in wingbeat frequency and amplitude means for the free-flight behavior of a mosquito?

      5. The electrophysiology prep is a significant advance in technique for the mosquito. It is great that similar types of compounds cluster together in the PCA odor map and seems to validate the approach.

      6. The results in Figure 4A are confusing because attraction to lactic acid increases after aversive training. It is unclear if this is indicative of learning because the unconditioned stimulus is aversive and the learned response is attraction. Perhaps this is some sort of sensitization to different odors, as lactic acid is generally reported to be an innately attractive compound to the mosquito. The unpaired control would be useful in this case. .

    1. On 2020-12-01 09:33:16, user nboccard wrote:

      If, as i read in Ruigrok et al., brain volume is about 11% bigger among males wrt. females, then SD male is mechanically 11% larger too. Thus your finding of larger SD by 27% (per my computation of your ratios) is decreased by as much. If so, the significance test may not pass.

    1. On 2022-08-18 15:08:16, user Ludovic Spaeth wrote:

      Thank you for sharing this elegant work on bioRxiv.

      I'd like to discuss the network inductive bias. The assumption about the normal distribution of inputs within the input layer might be correct in some discrete regions of the cerebellar cortex (https://pubmed.ncbi.nlm.nih... "https://pubmed.ncbi.nlm.nih.gov/19571137/)"). We performed systemic spatial mappings of granule cells to Purkinje cells (GC-PC) functional connectivity in a given module of the mouse anterior vermis (https://pubmed.ncbi.nlm.nih... "https://pubmed.ncbi.nlm.nih.gov/35102165/)"). In this particular region, however, GC inputs to PC are not normally distributed along the input layer, rather dispatched as strongly connected nodes intermingled with silent granule cell patches. <br /> Nonetheless, our data supports the idea that task-dependent optimal coding level should be somehow nested in a relatively invariant anatomical frame defined by the scattered mossy fiber - granule cell - Purkinje cell pathway.

      It is clear that the level of activation within the granule cell layer, when observed experimentally, seems to be much denser than theoretically expected. We previously discussed how one may reconciliate this contradiction between theoretical work and experimental data (https://pubmed.ncbi.nlm.nih... "https://pubmed.ncbi.nlm.nih.gov/35391650/)").

    1. On 2016-04-22 16:13:03, user Vladimir Seplyarskiy wrote:

      Dear Jonathan and colleagues,

      I have read your article and find it very interesting as it highlights violations of infinite site model. I would like to suggest a comment about interpretation of shifted SFS in sites considering mutations in other species. You observe that mutation rate varies within mutation class, thus you might expect higher mutation rate in sites containing mutations in other species.

      I would like to point out that we and others have already shown that mutation rate is several times higher in sites containing mutations in other species (Seplyarskiy et al 2012; Johnson & Hellmann 2011; Hodgkinson et al 2009). Variation in mutation rate may likely explain the decrease fraction of singletons among variants with mutations in other species. In our study we found that mutations in other species even on variants other than alleles in human population increase expected mutation rate. Moreover, transversion in one species is a better predictor for the transversion than for transition in other species.

      Good luck publication,<br /> Vladimir B. Seplyarskiy

    1. On 2020-04-06 16:25:34, user Hugh Gannon wrote:

      I noticed GART is a hit in the siRNA screen, which is also involved in purine biosynthesis. Do other members of the purine biosyntheis pathway (ATIC, PPAT, PAICS) come up as second-tier hits in the CRISPR or siRNA screens? Might lend more biological relevance to the pathway as a whole.

    1. On 2017-09-15 14:39:00, user benjamin vincent wrote:

      Hello Serghei, This looks like a nice analysis. For TCR, did you compare the performance of ImReP with TRUST (Li et al., Nature Genetics 49, 482–483 (2017)) and/or MiXCR RNA-seq mode (which in its latest iteration is optimized for RNA-seq data) ? For BCR, did you compare with VDJer (Mose et al, Bioinformatics 2016 15;32(24):3729-3734. - Disclosure: I was an author on the VDJer paper)? Also did you compare against amplicon datasets from Adaptive for biological validation? -Benjamin Vincent

    1. On 2019-02-16 22:44:42, user Seth Bordenstein wrote:

      A few comments and thanks for posting and sharing your article. Hope this helps.

      A. Note that primers which joined the two types of cifs (in your paper cid and cin) hit a repeated sequence and possible insertion site as a template and not the flanking regions that include the CI genes. So it is possible that you may have sequenced the repeated intergenic regions, and not the actual flanking regions for the junction. The forward primer is repeated in prophage WO regions (e.g., head, tail genes). The reverse primer is in the intergenic region adjacent to the transposase and could very well be part of a repetitive insertion site for the transposase sequence. If you push your primers out to the adjacent CI genes, you might reliably see if this is artifactual joining or not. We’ve been through something similar in the lab. All that being said, it would be very interesting if wYak swapped its Type I cifs for some other Type cifs in the same location, as the singular contig in Figure 5 implies. This could be confirmed with PCR and Sanger sequencing.

      B. Figure 5 wMel shows a 5Kb gap between 632 and 633, but we only detect a 1Kb gap in the genome; that’s how we illustrate in our schematics too. Double check that. Seems off? Note there are definitely no other cif genes in that Type I family.

      C. wYak cifB has a truncation at the N terminal end that may or may not ablate its function. Important to note that wRi cifB has a similar N terminal truncation and yet may cause strong CI. Nothing to really stress here, just pointing it out for context

      D. Line 32 - Important to cite that WO prophage loci cause and rescue CI (Shropshire 2018). Only one group has shown rescue of CI in flies.

      E. Line 34 - Now established that wMel can cause strong CI under the right conditions. Important to clarify.

      F. We typically italicize genus names throughout, unless there are some journal specific rules.

      G. Lines 347-350. Note that only the A protein, not the B protein, was found in spermatheca of mated females. Also note that Beckmann et al did not show rescue in D. melanogaster as implied by the citation and wording. Rescue in flies was only shown by Shropshire et al. 2018.

      H. A likely explanation for transfer of CI loci is that phage WO rampantly transfers between A and B Wolbachia. This literature should be cited as a highly probable explanation for the transfers.

      Great system and lots of fun ahead.

    1. On 2021-06-30 19:11:57, user Roberto Efraín Díaz wrote:

      In your article, you refer to 3FY1 as a murine AMCase. It is a human AMCase expressed in Chinese Hamster Ovary (CHO) cells. Have you considered using Rosetta to build a homology model of murine AMCase using 3FY1 as a template?

    1. On 2019-10-02 14:19:18, user Tom & Tom wrote:

      This paper was submitted to a journal and was rejected with the following main concerns (paraphrased here by the manuscript authors):

      1) The paper lacks details on the custom microphone used, and the testing protocol, making reproduciblity of our experiments impossible.<br /> 2) The paper should have included a more extensive assessment of the drones in real-world data collection scenarios to demonstrate their effectiveness<br /> 3) More detail on the drones' construction is needed so that others can reproduce them<br /> 4) More detail is required on the exact modifications made to reduce noise and quantification of the impact this had on signal to noise ratio.<br /> 5) More detail is needed for the real-world tests, including flight duration, adherence to regulation, calls per unit time, and comparison to static or 'on-foot' surveys of the same location.

    1. On 2021-04-01 18:00:35, user Frances Kona wrote:

      THERE IS CURE FOR HERPES VIRUS. this has been a great opportunity for me to speak about Doctor mohammed concerning his HERBAL MEDICINE for the cure of HERPES VIRUS. please visit doctor mohamed facebook page www.facebook.com/Herpes-cur... i am a living proof of the cure, it is not a story any more, thank God i gave him a try to cure me, i was confirm 100% negative after the usage of the herbal medicine, it is like a dream to me that Doctor Mohamed herbal medicine could cure herpes virus to 100% negative, before i proceed further let me quickly share his contact to the general public so anyone suffering from this virus can also have an opportunity like this to be cured. WHATSAPP/CALL +2349036036397 EMAIL- herbalcure12@gmail.com .Please let every Herpes patient give a herbal medicine a try. It works perfectly well. don't be deceived any more that there is no cure. This herbal medicine was shipped from Africa to me here in the United States by dhl. I am so happy to have seen my health and life back to normal. Thank you Doctor Mohammed --*----*

    1. On 2020-10-31 20:24:40, user Janet Lee wrote:

      This is the first study to link cytokine mediated inflammation and cell death pathways in COVID-19 infection. STAT1/IRF dysregulation appears to be a common signature observed across studies this study by the Kanneganti lab opens up therapeutic possibilities for patients exhibiting cytokine storm phenotype in severe COVID-19 disease.

    1. On 2015-06-19 00:48:10, user Niranjan Nagarajan wrote:

      Thank you for the feedback and comments. A new release of OPERA-LG with more error-reporting and a few bug fixes is out. This should hopefully handle BWA input better. The code for PacBio scaffolding should be out soon as well. Finally, we will expand on the staged-strategy in a revised version of the manuscript to make it clearer.

    1. On 2024-12-12 18:59:34, user Adrien Jolly wrote:

      Dear authors,

      Thank you very much for this great study. Many smart ideas, much food for thought.<br /> I have a specific concern regarding figure 6. If I understand correctly, you make the assumption that the frequency of Ki67 positive cells directly correlates with proliferation speed. I find this assumption problematic, Ki67 protein accumulates in S-G2M and is degraded in G0/G1 (see for instance PMID: 30067968). One can find that, at steady growth, a shortening of SG2M will actually reduce the proportion of Ki67+ cells, (a shortening of G1 will however increase it), depending on these parameters, the growth rate of the population could be significantly larger for big clones with no change to the proportion of Ki67+ cells. With the Fucci markers combined with ki67 you might be able to resolve this question, but I can imagine it would be very difficult to also identify different clones in this case.

      Cheers,

      Adrien

    1. On 2015-03-18 14:45:21, user Andrew Brown wrote:

      This is a new version of the paper, to match a new version of the software hosted here: http://www.sanger.ac.uk/res...

      The changes are:

      1) The software can now take input from the stdin, allowing it to be incorporated into a pipeline.<br /> 2) The spline function for estimating pi0 now matches that used by the qvalue package, meaning both implementations will now give the same results. In my experience, the new FDR estimates tend to be slightly less conservative than previous.<br /> 3) There is a new --sep flag, specifying the delimiter to be used in the output.

      Andrew Brown

    1. On 2019-03-27 23:43:44, user Arie Horowitz wrote:

      Dear authors,<br /> May I provide some feedback?<br /> 1. The experimental data is sparse relative to the sophistication of the model.<br /> 2. Ex-vivo and in vivo (in zebrafish) testing of the predictions of the model would obviously <br /> increase the physiological significance of the study.<br /> 3. VE-cadherin may translocate from cell junctions without the formation of a physical gap. <br /> Visualization of f-actin would be a more robust evidence of gaps.<br /> 4. The videos are not accessible on this website.

      Best regards

    1. On 2017-03-01 05:32:47, user Rob Lanfear wrote:

      My lab just read this preprint, and I thought I'd pass on our thoughts in the hopes that they are helpful.

      First, we thought the approach seems eminently sensible, very useful, and that the analyses were informative.

      A few things we thought might be worth considering:

      1. Similar to some comments on Twitter, we wondered about the choice of variant callers to include as comparisons, and why many commonly-used callers were excluded.

      2. We found the table really hard to interpret. Perhaps this is just because it's difficult data to represent, but we did wonder about the extent to which the sets of variant calls overlapped / differed, as well as the FP and FN rates. It also took us quite a bit of head scratching to get to the point where we realised that the dbSNP138 column percentages were so important to the interpretation.

      3. We found the definitions of False Positives and False Negatives confusing (we appreciate that there are limitations to the short format though). This is mostly because it seems from the dbSNP138, Omni 2.5, and other results (final para of the ppr), that many/most of the False Positives are probably not False Positives at all. For this reason, we thought it might be clearer to redefine FP and FN simply in terms of differences to the GIAB NA12878 data.

      4. Related to 3, but also more generally, we really wanted to see some simple simulations, so that one really could determine FP and FN rates. For my money, a simple and effective approach here is to do something like the NextGenMap paper (https://academic.oup.com/bi... "https://academic.oup.com/bioinformatics/article-lookup/doi/10.1093/bioinformatics/btt468)") which simulated 4 read sets from Human, Arabidopsis, and Drosophila, then another 11 read sets from Arabidopsis with increasing polymorphism (0-10%). Results could be summarised quickly in a single figure, comparing real FP and FN rates under simulation.

      A final comment, not really relevant to the current paper: we wondered about extending the method to include technical replicates (i.e. independent extractions and libraries from the same sample). E.g. to include 3 technical replicates at 20x each, which should allow one to account quite effectively for errors from library construction and base-calling.

    1. On 2020-10-13 07:28:47, user Tony Hillier wrote:

      Is the cause of H.pylori a factor in choice of best treatment please? ie whether bacteria or anti-inflammatory drugs caused?

      Friend in Kenya has it and considering kefir treatment.

      Thanks

      Tony UK

    1. On 2020-07-02 08:56:10, user °christoph wrote:

      Fantastic work. Clearly a study that advances the understanding of FtsZ-dependent divisome formation and therefore deserves rapid peer-review and publication. However, here - and elsewhere - it has become fashionable among authors to refer to previous work on their subject as "...remains poorly understood." This expression tends to devalue previous efforts, which is especially unfair in this case. A phrasing like "...not completely understood" or, maybe, "...not well understood" could express a more modest recognition of their own work as yet another of the customary incremental steps towards an understanding.

    1. On 2023-10-05 06:23:48, user John McBride wrote:

      Thanks for the comment. This is a very good question. I will refer to the energy-minimized structures as "relaxed" and otherwise "unrelaxed". In this work I only analyzed the relaxed structures.

      There were so many different things to check that I never got round to checking the effect of energy minimization originally, but I did make sure to save all of the unrelaxed structures. So I re-ran some of the analyses (originally done on the relaxed structures) with the unrelaxed structures.

      (1: Structure correlations) When comparing AF-PDB correlations for pairs of structures where sequences differ by 1-3 mutations, relaxed and unrelaxed structures give almost identical results. For the case of no mutations, the correlations are actually higher for unrelaxed structures (r=0.38) compared to relaxed structures (r=0.33). This would reduce the residual correlations in Figure 1H by about 0.05. For reference, in Figure 1H the residual AF-PDB correlations range from about 0.15 to 0.35.

      (2: Blue fluorescence correlation) I checked the strongest AF-phenotype correlation, from Figure 2C. For unrelaxed I get r = -0.92, for relaxed I get r = -0.93.

      It seems that the energy minimization does help, but it is certainly a minor part of the overall prediction.

      Bear in mind that this analysis is nowhere near as extensive as what went into the paper, so I might have missed something. The paper has now been accepted, so I don't think it is possible to add this in a new version.

      Thanks again for asking this important question. I'm personally glad to know the answer (even if it is a bit preliminary).

    1. On 2023-10-24 01:24:43, user Anshule Takyar wrote:

      Hello! This is a good piece of work, and the value to the field is very evident. It is great to see novel sequencing methods like Oxford Nanopore sequencing being validated more and more, and by employing a Nanopore-only approach, you have probably helped to assuage some of the anxieties of others in the field regarding this technique. I had a few questions and recommendations regarding this technique. Have you sequenced T. cruzi, or the Tulahuen strain specifically, with short-read sequencing? Are there any hurdles involved with that? Also, do you think that by assembling this genome using the help of short-read sequencing, you would have gotten a better result? Additionally, I think that it would be helpful to show in a figure which coding regions are not impacted by transposable elements, as that would increase the significance of your work. Other than that, I really liked this work, and congratulations!

    1. On 2019-11-21 00:43:46, user Charles Warden wrote:

      While I haven't directly worked with Nanopore data myself, there was a clear effect on species assignments in this paper (when using full barcodes versus mini-barcodes), as you can see in the comment:

      https://www.biorxiv.org/con...

      For Illumina, I am not sure how you are defining "full" versus "mini" barcodes, but I have definitely encountered enough issues with "index hopping" that I am at least a little concerned about discussions with increased multiplexing (even though cross-contamination can occur at various steps).

      In terms of what I can currently cite, I have some notes on Biostars about possible QC metrics for de-multplexing:

      https://www.biostars.org/p/...

      While the PhiX is kind of a special case (which I believe you typically only see with single-barcode samples, even though I would guess there are probably other events that are more difficult to define). However, since PhiX spike-ins don't have a barcode, that is one example of a de-multiplexing issue includeed in that discussion:

      https://www.biostars.org/p/...

      Otherwise, I noticed drops in I2 (i5) index quality scores (with 100x100 reads), which might be a red flag for some runs (and a possible disadvantage to having a second barcode to assign samples).

      While I think the most important point for Illumina de-multiplexing is that these problems are often batch effects (hard to see unless you consider a large number of batches), there was a more limited example with a small fragment size (to show that you can get at least some wrong sample assignments, even with Illumina dual-barcodes):

      https://github.com/cwarden4...

    1. On 2018-04-14 14:10:02, user Arun wrote:

      Worldwide Patterns of Ancestry, Divergence, and Admixture in Domesticated Cattle<br /> http://journals.plos.org/pl...

      Bos taurus taurus was domesticated in the Middle East while Bos taurus indicus was domesticated in India.

      It is likely is that a hypothetical Punjab_N population from even before agriculture would have been related to the Iran_N people, somewhere along a cline between Iran_N in Iran (whose aDNA has been found) and peoples in India's interior.

      If Iran_N(eolithic) ingressed into India with a demic diffusion of agriculture, they didn't bring their cattle along.

    1. On 2018-06-12 12:28:42, user Christophe Lamaze wrote:

      A great study with the first cryo-EM on these intriguing tunneling nanotubes. A big step forward as this study convincingly shows that TNTs are structurally different from filopodia and that it can exchange, as nicely visualized here, cargos between distant cells. Beautiful work!

    1. On 2022-02-08 20:31:53, user smd555 smd555 wrote:

      Dear authors! My question is - what is the current understanding of the genetic origin of the Baltic bronze (namely, samples from Kivutkalns)? Can they be unambiguously derived from previous known genetic components, or is some component missing? Thank you.

    2. On 2017-03-08 18:29:21, user Jørgen K. Kanters wrote:

      Very interesting and important paper. Only one comment: In extended data table 1 You use the ISOGG haplogroup nemes like I2a1a2a1a. These names have the drawback that they often changes dynamically when new haplogroups are found, and will likely be outdated at some time. Why are You not using the terminal SNP (or at least in paranthesis) instead

    1. On 2020-02-01 23:01:05, user AronF wrote:

      We really ought to be given the 'E value' of the BLAST hits to the HIV sequences in order to determine the actual "unlikely[hood]" of the 2019-nCov matching the HIV-1 inserts. That is the very reason the E-value exists. The fact of 100% coverage means little if there is an abundance of hits with 95% coverage for example - in this case the E value would be high.

    1. On 2022-06-30 05:39:56, user NATTASIT PRAPHAWI wrote:

      Hi, you have done a great work! <br /> 1) I noticed that you might need a correction on Fig.7 <br /> "Fig.7 Chromatin condensation promotes ~~osteogenesis~~ adipogenesis of hMSCs cultured on soft hydrogel"<br /> 2) It would be great if hMSCs cultured on stiff hydrogel were included as a control in every experiment.<br /> Best,

    1. On 2020-07-15 20:02:08, user Nick Miller wrote:

      Nice work!

      One minor technical question. Might the "lag" seen in DvvGr43-mediated effects (lines 444 - 454) simply be due to a lag in receptor knockdown by RNAi? Even if RNAi gets rid of the DvvGr43a mRNA quickly, it could still take a while for protein turnover to clear out pre-existing receptor molecules.

    1. On 2019-09-19 16:14:12, user H. Etchevers wrote:

      I had previously pointed out that Kaspersky antivirus had flagged the website as engaging in phishing. After I asked them to look into it, they have now removed the flag as a false positive. ("It has been confirmed as a false positive. The link will be excluded from our anti-phishing databases.")

    1. On 2025-07-08 17:07:35, user Danny Yupa wrote:

      The methodological approach you propose through the Genetic Diversity Index (GDI) represents a significant advancement in incorporating the genetic dimension into spatial biodiversity analyses. It is particularly valuable due to its scalability and the use of already available public data. However, its implementation presents methodological and structural limitations that must be urgently addressed to ensure robust and applicable results. The exclusive reliance on GenBank introduces clear geographic and taxonomic biases, as regions such as Eastern and Northern Europe are underrepresented, as well as ecologically dominant families like Asteraceae and Rosaceae. This unequal coverage can distort the patterns of genetic diversity presented, affecting the representativeness of the index. Moreover, reducing genetic diversity to a single metric ? significantly limits the analysis, excluding key aspects such as heterozygosity, genetic differentiation, and population structure, which are fundamental to assessing genetic health and connectivity. Another important issue is that the GDI assigns equal weight to all species, without distinguishing those that are rare, functionally important, or endangered. This may lead to a biased prioritization that favors regions with more available data rather than those with greater conservation urgency. Additionally, the study does not present a clear proposal for how to integrate the GDI into public policies, restoration plans, or protected area systems, nor does it consider current threats such as land-use change or habitat loss. Therefore, we recommend complementing GenBank with other genetic databases such as EMBL, BOLD, or GBIF; incorporating additional metrics that better reflect actual genetic diversity; establishing ecological weighting criteria among species; and linking the index’s results with real-world conservation scenarios and decision-making. With these adjustments, the GDI could become not only a methodologically robust tool, but also a practical, equitable, and useful instrument for the global conservation of genetic biodiversity.

    1. On 2018-12-17 17:07:52, user Mariana Schuster wrote:

      Thank you for posting this preprint. I am glad to see some experimental evidence around the conservation of effectors in “non-pathogenic” smut fungi. In particular I like the idea of encouraging people to study these species more in detail.

      Here some thoughts and questions:

      Given that “smuts” has many definitions. I would precise your definition in the introduction. I believe you are using here the term smut as synonym of: belonging to Ustilaginales?

      If I understood it correctly, your hypothesis that Pseudozymas might be pathogenic is based on the fact that P. prolifica is conspecific with U. maydis. Another piece of data supporting this hypothesis, at least for some former Pseudozyma species, and that you might like to mention would be our comparison of the secretome of two Pseudozyma species to those of plant pathogenic smut fungi (https://www.sciencedirect.c... "https://www.sciencedirect.com/science/article/pii/S1087184516301530)") These data also suggest that not all former Pseudozyma species might still be pathogenic, something one could also discuss in the context of this manuscript.

      Where do the 211 core PSEPs come from? I could not extract this number from Sharma et al, 2015.

      Given that comparative genomics results highly depend on the quality of the genomes used, I would suggest to provide quality data on the genomes you are using or comment on this in the manuscript especially since you are working with some draft genomes (according to the cited publications). I would expect even more conservation when using high quality genomes.

      Line 40. You mean “penetrating the host for colonization”?

    1. On 2019-06-24 21:29:29, user ThePatrickWatsonLab wrote:

      Hello! Very nice paper-- we are also interested in post-translational modification of SR proteins. I am wondering if you could provide more clarity regarding your phos-tag gels. They way they are currently labeled, they are difficult to interpret. Is it possible to include size markers?

    1. On 2017-09-17 21:09:51, user shengchao li wrote:

      This is a mini-review of this article by Metz, DG and Brainard, MS. Praises are omitted. Only concerns that may potentially improve the article are presented. I do not have major concerns. Follwing are some minor concerns.

      1. Reference 12 should have only 2 authors (Mandelblat-Cerf and Fee) but 6 authors were listed.
      2. There are both learners and non-learners of songbirds. The first paragraph of Introduction sounds like there are only learners. Also the song structure described there may be specific to certain songbirds.
      3. Fig 2C caption said the matrix was M by N. Should that be N by M?
      4. Fig 5B. The curves should not start from zero. This point will be apparent if a non-deafened control curve is added to the plot. It would start from zero, deteriorate at week two and keep flat afterwards. This would be misleading. The correct way is to use a separate set of songs for each of the birds before deafening, compute their CE's with their reference sets, and use these CE's at time 0.
      5. It is not clear from the text or caption of Fig 6 whether the data was from Bengalese finch or from Zebra finch. I guess they are from Zebra finch. But it was not indicated.
      6. Figure 6D caption does not match Figure 6D.

      Thanks.

    1. On 2018-02-09 10:33:44, user Chris Foulon wrote:

      We organized a Preprint Journal Club with the Frontlab (at the Brain and Spine Institute in Paris) to discuss and propose a review of this paper. Don't hesitate to contact us to further discuss.

      PREPRINT REVIEW<br /> Participated to the Review:<br /> Chris Foulon, Daniel Margulies, Antoni Valero-Cabre, Benedicte Batrancourt, Pedro Alves, Richard Levy, Alexandre Routier, Marcela Ovando Tellez, Johan Ferrand-Verdejo, Angélina Bourbon, Emmanuelle Volle, Lara Migliaccio, Chloe Stengel, Michel Thiebaut de Schotten<br /> In their paper, entitled 'An empirical, 21st-century evaluation of phrenology', Jones et al. revisit the phrenological ideas of Gall and Spurzheim using modern neuroimaging techniques.<br /> Principles established by Gall at the beginning of the XIXth century were essential for establishing localizationism as a framework for brain mapping. Such approaches remain central to the methods we employ today in any study that compares voxels across individuals. In addition, the notion of a statistical association between localized brain shape and function is still very much alive in voxel-based morphometry, cortical thickness and Jacobian determinant analyses. However, one of Gall and Spurzheim's assumption, that the shape of the brain induces relatively sharp changes on the surface of the skull, and therefore that the surface of the skull can be used to infer the form of the brain, has been broadly dismissed as wrong. Empirical evidence for discarding the phrenological hypothesis is nevertheless lacking, and constitutes the focus of the current study.<br /> First, we want to salute this scientific effort. Notably, the concept of phrenology and the motivation to carry on this research is very well explained. The authors employed one of the most powerful dataset (uk biobank n=6000) to assess whether or not there was some truth behind the Gall and Spurzheim's assumption. In brief, the study found no significant relationships to support the phrenological hypothesis. <br /> However, as it currently stands, we felt the analyses fell short of adequately supporting the negative conclusions of the study. The analyses make substantial efforts to test the principles put forward by Gall and Spurzheim, but we believe the study could provide further insight by instead testing their hypotheses. In other words, our field is largely founded on the hypothesis that variation in localized brain structure relates to differences in behavior. This can be directly linked to the phrenological hypothesis of Gall and Spurzheim. However, if phrenology is empirically demonstrated to be wrong, and our current framework is right, where does the relationship between morphology and human behavior breakdown? Are the behavioral categories of Gall and Spurzheim to blame? Or is the assumption that skull morphology reflects local variation in cortical morphology faulty? We believe that tracing the assumptions of phrenology more closely with respect to current neuroscientific approaches could provide both a judicious assessment of a long-maligned field, but also further insight into where our own current assumptions succeed and fail. <br /> More specifically, we would offer the following suggestions for consideration by the authors:<br /> First, testing lifestyle but not real neuropsychological tests do not really assess the hypothesis of the link between the functional specialisation of a brain area, its size and its subsequent deformation on the skull. Additionally, the multiple regression discretely assume a proportional relationship between the measures whereas we have reasons to believe that Gall and Spurzheim had a more bimodal vision of the phrenology (bump or no bump that is the question).<br /> Second, the methodology could be further clarified to provide a clear argument.<br /> T1w images were aligned linearly in the MNI152 linear then surfaces were created to compare the curvature of the vertices between participants. Such approach will capture changes in curves, but not plateaus. This means that the measure the authors have chosen will be sensible to the scale and is underpowered to detect big cranial bumps. A surface ratio measure applied to the skull surface might be more accurate. Alternatively, would a Jacobian approach be more appropriate?<br /> Comparing vertices one by one increase drastically the number of comparisons (= no significance), how about directly testing Gall's parcellation?.<br /> Gyrification index is not a measure of the local volume of the brain and is not assessing the relationship between the size of brain areas and deformation of the skull. <br /> Finally, a univariate regression, rather than a multivariate regression, would be more appropriate and respect better the standard phrenological practice. <br /> Result section should be expanded. Particularly, non-significant statistics do not demonstrate the inexistence of an effect. What does meaningful really mean here?

      A few suggestions <br /> Letter fluency can not have dof = 18<br /> How were the 3D meshes transformed into a sphere? <br /> Can people expand on the potential future research related to the correlation between fluency and the number of sexual partners? <br /> Is there some covariance in the skull morphology?<br /> It would be interesting to use a stepwise analysis of the surfaces that are modelled to see when their relationship breaks down.<br /> Can the authors run the same analysis as Smith et al. 2015?

    1. On 2022-10-31 15:54:07, user Daniel Lüdke wrote:

      Figure 5: It would have been interesting to see the water-soaking phenotypes as these would have been expected to appear at around 24. Can a water-soaking phenotype be “reversed” once plants are shifted from LD to LL 24h after Pst infection. Same for the stomatal aperture.

    1. On 2018-03-18 12:55:06, user Grimm wrote:

      A few things:

      If you want to get feedback, you may want to include the main text figures in a better resolution. The large chronogram looks fun, but one can't read the names. You could provide a version of your chronogram (ultrametric tree) that can be opened with a treeviewer such as FigTree or Dendroscope.

      And although I find the general idea worth exploring, I worry a bit about your data base: the divergence in atpB and rbcL differs profoundly from that in the matK, and the same holds for 18S (highly conserved) and 25S (about same level as matK, but focussing on different aspects of angiosperm phylogeny). Also, towards the leaves of your angiosperm tree, the plastid and nuclear signals are not fully congruent. Forcing incongruent data into one tree increases the branch lenghts (missing data can have the same effect), which may (or may not) be critical to your BAMM analysis. <br /> For one tiny bit of your tree, the Fagales subtree, I can assure you that 18S vs. your plastid genes is comparing apples with pears, we just had a post on Genealogical World of Phylogenetic Networks (GWoN) about it: <br /> http://phylonetworks.blogsp...

      For the Santalales there maybe similar issues, but I only re-analysed the Loranthaceae neighbourhood; details/links can be found in this GWoN post:<br /> http://phylonetworks.blogsp...

      I couldn't find any information about the gappyness of your matrix or nuclear-plastid congruence. According Supplement Table S1, at the genus level there are no gene gaps, but what about within-gene missing portions?

      You also use a lot of old sequences of mediocre quality, the L... and U... accessions have not a few pseudomutations/editing artefacts. I realised this when I recruited the Soltis et al. (2011) matrix for a total evidence experiment (see footnote 7 in this post: https://researchinpeace.blo... "https://researchinpeace.blogspot.fr/2017/12/age-of-angiosperms-may-palaeobotany.html)"). I ended up spending some time cleaning out the old accessions (L.../U....) and replacing them by cleaner, newer data from genebanks, not rarely from Soltis et al. themselves. In particular the 18S and 25S partitions are not in good shape in Soltis et al.'s (2011) matrix. It is poorly curated. They just add new genes with every paper, but never bothered to update the older partitions. And rbcL, 18S, 25S, atpB and matK are among the very first ones. My feeling is that this is a neclectable problem with respect to the breadth of your data set. I uploaded my curated matrix (reduced taxon set that fitted our needs, nevertheless includes all your gene regions) to figshare: https://doi.org/10.6084/m9..... Mainly, you don't want to include re-transcripts of originally sequenced 18S and 25S rRNA fragments (by the way, in plants its "25S" [or "28S"], "26S" is a widespread error that sipped into phylogenetic literature in the late 90s).

      As I see it, you would need to infer single-partition trees, so one can assess the contribution of each gene to the combined tree and its branch-lengths. At least run a nuclear vs. plastid analysis, just to make sure you have no incongruence-induced artefacts.

      And I hope, once your paper is published (I have little doubt it will be), you will provide your matrix as open data (why? See again this GWoN post: http://phylonetworks.blogsp... "http://phylonetworks.blogspot.fr/2018/02/we-want-to-publish-our-phylogenetic.html)")

      Probably a nice and interesting paper, but lacks a bit awareness about the primary signal isssues in the used data (not uncommon in dating studies)

      Cheers, Guido

    1. On 2021-05-04 14:53:07, user Brian Haugen wrote:

      The SPIRES database and method is described in the article below, if you’d like to cite it.

      Metrics associated with NIH funding: a high-level view<br /> https://www.ncbi.nlm.nih.go...

      Boyack KW, Jordan P. Metrics associated with NIH funding: a high-level view. J Am Med Inform Assoc. 2011 Jul-Aug;18(4):423-31. doi: 10.1136/amiajnl-2011-000213. Epub 2011 Apr 27. PMID: 21527408; PMCID: PMC3128410.

    1. On 2018-12-10 22:32:28, user jwilliams wrote:

      The paper, by Tian, et al., seeks to address the issue of chemoresistance in hepatocellular carcinoma (HCC) treatment as it is a common solid-organ cancer that frequently develops chemotherapy resistance. Due to a lack of early symptoms in HCC, the disease is often caught too late for surgery, and therefore relies heavily on chemotherapy for treatment. The authors focus on RNA-binding protein Lin28B which promotes liver cancer through downregulation of anti-onco-miRNA expression. Their main objective is to assess the role that Lin28B plays in chemotherapy resistance, and explore how curcumin can be used in combination with chemotherapy agent paclitaxel to sensitize Lin28B overexpressing Hep3B cancer cells, and a Hep3B paclitaxel resistant cell line, to paclitaxel treatment. Their work does a great job of showing the direct impact of Lin28B on paclitaxel resistance, and how the usage of curcumin in combination with paclitaxel can be used to more effectively treat paclitaxel resistant Lin28B overexpressing HCC cells. This work adds valuable knowledge towards creating more effective cancer treatments, and especially treatment of cancer that has become resistant to chemotherapeutics.<br /> There are, however, a few concerns that I would like to share that may add to this paper. A minor critique addresses unclear interpretation of the results. Other critiques seek to understand how Lin28B, as an RNA binding protein, is mechanistically causing chemoresistance, and why they only look at paclitaxel, and its resistance, in HCC.<br /> The minor critique is aimed at addressing a confusing interpretation of Figure 5C. The figure interpretation in the results state that expression of apoptosis-related proteins was significantly reduced in tumors that underwent the combo treatment. This statement only addresses half of the result because they are looking at both apoptosis effector molecules like cleaved caspase 3, which increases, as well as anti-apoptotic protein BCL-2, which decreases. I would consider cleaved caspase 3 an apoptosis related protein, and since it increases, it directly conflicts their statement in the results. They should include more detail to specify that apoptosis effectors increase, and anti-apoptotic apoptosis proteins like BCL-2 are the proteins that are decreasing.<br /> A more broad critique is concerned with why the authors did not investigate the mechanism behind how Lin28B, as an RNA binding protein, is functionally involved in chemoresistance. In the discussion, they state that due to Lin28B overexpression inhibiting apoptosis in HCC cells, they suggest that Lin28B may be regulating apoptosis protein activity, but they never explored this experimentally or showed data. I believe that further experimentation to show the mechanism behind Lin28B mediated resistance to paclitaxel should be conducted, and could add impact value to the paper. Due to Lin28B’s involvement in blocking let-7 microRNA biogenesis, which derepresses let-7 target genes, the authors could start by exploring which pathways affected by let-7 targets would likely lead to chemoresistance. These could include pathways that lead to apoptosis resistance, increased production of proteins that would degrade or protect from drugs, or prevent the direct effects of paclitaxel. If they could show, for instance, that perhaps Lin28B is inhibiting microRNAs involved in regulating anti-apoptotic proteins like BCL-2, this could elucidate the direct mechanism of Lin28B on effecting chemoresistance. Investigating this mechanism would be a great addition to the understanding of how Lin28B, as well as other RNA-binding proteins, might be involved in chemoresistance. As this is a major focus of the paper, I feel that it would greatly enhance their narrative.<br /> A final point is about whether or not Lin28B mediated chemoresistance is specific to only paclitaxel. I believe that including an experiment using their Lin28B overexpressing Hep3B HCC cells to screen several other chemotherapy drugs would help to expand the impact of this work beyond a single drug. Additionally, the curcumin and drug sensitization experiment could be ran on any of the other drugs that are affected by Lin28B-mediated resistance to see if the treatment improvement seen with curcumin and drug combination also applies to other drugs affected by resistance.

    1. On 2019-09-08 06:18:22, user Jing Lu wrote:

      I compared the results generated by Kraken and CCMetagen and got a more accurate one by using CCMetagen. Thanks for providing a good tools for metagenomic. I found the abundance description in CCMetagen result is not a integer. Can you have some explain on this? Many thanks.

    1. On 2019-04-19 20:47:05, user Stephanie Gogarten wrote:

      It will be interesting to see how much this can speed up current WGS analysis pipelines that rely on VCF!

      The reference to "Stilp et al." is incorrect, it should be listed as "Zheng et al.".

    1. On 2020-02-24 22:03:07, user Fraser Lab wrote:

      The authors propose a method that would automate atomic model building for near-atomic resolution cryo-EM maps of proteins for which no prior structural information is available. The proposed method is discussed in the context of segmenting cryo-EM maps of a multi-subunit protein complex in order to accurately identify individual subunits. The advantage of this method is that it allows for accurate model building of a multi-subunit complex when there are no structural models for individual subunits by leveraging evolutionary couplings (as a scoring criterion and as a validation metric). Overall, due to the lack of benchmarking against other methods and the limited test cases examined here, we are not yet sure whether this manuscript demonstrates that the method is robust or that it presents any advances over existing methods that do not rely on evolutionary couplings.

      The authors state that their proposed method will improve segmentation of cryo-EM maps, but there is little discussion of how their method addresses this task. The majority of the paper focuses on model building, not segmentation. On page 4, the authors outline several tasks involved in “tracing a chain in the EM density map of a multi-component complex… i) the map needs to be segmented into sub-maps of the individual components; ii) probable locations of amino acid residues need to be identified in the map; iii) these locations need to be assigned to the primary sequences of the components; iv) full atom models of the protein need to be constructed.” Of these tasks, only the first one is relevant to the proposed method. The other tasks, including “automatic map segmentation, automatic map sharpening, automatic interpretation of multiple chain types, and automatic application of reconstruction symmetry” have already been implemented by software packages, some of which this manuscript cites (Cit. 10 - Terwilliger et al 2018; Not cited - Terwilliger et al, 2019 doi: 10.1002/pro.3740 also see: “Automated Segmentation of Molecular Subunits in Electron Cryomicroscopy Density Maps” by Baker et al, 2006). It may very well be that this method is a major advance over these previous studies, but it is currently impossible to tell from the manuscript.

      The major flaw in what is presented is that the proposed method is not rigorously tested on multiple test datasets (e.g those that are publicly available on EMPIAR or EMDB). Rather, the method is used to build a model into a map of the TssF protein, a subunit of the Type 6 Secretion System baseplate. However, the authors modify their method to skip steps 1 and 2 (including the map segmentation, supposedly a major strength of the method) due to the low resolution of the map. The motivation for using a Minimum Spanning Tree in the method is not well described, especially in the absence of significantly improved results relative to existing methods. This brings into question over what resolution range this method is appropriate. It is also concerning that the authors report building an atomistic model of TssF and TssG components, but do not include the model in their manuscript or a statement about PDB deposition.

      The authors acknowledge the necessity of sequence information from numerous protein homologs in order to accurately create a contact prediction map, one of the required inputs in their method. It would be informative for the manuscript to include benchmarking that demonstrates how many sequences or contact couplings are necessary for accurate segmentation. This can be achieved by plotting the local correlation per amino acid residue against a varying number of input sequences. This section could also be strengthened by a discussion in the manuscript of how sequence co-evolution information relies on sequence conservation and how this information may not be useful if homologs are highly divergent.

      Finally, we encourage the authors to make the code for their method publicly available so it may be more widely useful and transparently understood.

      Minor Points<br /> There is no comparison of the author’s proposed method and the automation tools provided within Coot, yet the authors declare that Coot’s tools are “largely manual, time-consuming, and prone to subjectivity.” There is also no comparison to Rosetta or Phenix. For example, running: phenix.map_to_model emd_2513.map 4ci0.fasta.txt resolution=3.4 find_symmetry=True does a pretty good job tracing the majority of the chains (in about 3 hours on a laptop), but does not perform as well as what is potentially described here. Comparison would be helpful for demonstrating the proposed method’s added capabilities, if any, or establishing the method as a less or more computationally intensive alternative to Coot, Rosetta or Phenix.

      The Results section contains a great deal of detail that would be better laid out in the Methods section, not only for organizational purposes but also to make explicit what steps are intended to be routine. As written, the manuscript suggests a nontrivial number of judgement calls will be involved in applying the method, detracting from its usability by a wider audience.

      Figures<br /> Fig 3 - Predicted contact maps vs final contact maps<br /> This figure does not clearly compare predicted and final residue contacts.

      Fig 4 - Alignment and comparison with reference model<br /> It would be easier for readers to interpret comparisons if presented with individual chains. The reference model could be overlaid with the final model for easy visual comparison (similar to the visualization of multi-conformers).

      Fig 6 - Method applied to wedge complex of bacT6SS baseplate<br /> 6A - Can the authors compare their model to a deposited model (in addition to other benchmarks listed above)?

      We review non-anonymously, James Fraser, Iris Young, and Roberto Efrain Diaz (UCSF) and have posted this review on BioRxiv as a comment.

    1. On 2022-10-21 03:51:47, user Jared Roach wrote:

      The distribution of random fragment lengths is a beta distribution. (Roach JC. Random subcloning. Genome Res. 1995 Dec;5(5):464-73. doi: 10.1101/gr.5.5.464. PMID: 8808467.) Maximum fragment length is not a robust statistic - it has high variance.

    1. On 2020-11-06 11:18:38, user Nabil Hajji wrote:

      Since we placed our paper in the BioRxiv we have received huge number of emails from editors of distinct journals. We are please with that, however, our paper is novel and great research story with substantial data and international collaboration. Therefore, our manuscript should be published in well respected and major journal.

    1. On 2021-01-29 15:06:35, user Martin R. Smith wrote:

      A potentially minor point, but I wonder whether the Robinson–Foulds distance is the best measure of discordance in this situation? It's possible that misplacement of just one taxa could result in a high number of edges not being recovered, and this sort of error might occur more or less frequently under different methods. I've reviewed the performance of distance measures new and old across a range of scenarios in Smith (2020, Bioinformatics): https://doi.org/10.1093/bio...

    1. On 2020-02-27 12:18:15, user Michael wrote:

      This very useful report (not paper) on building new fluorescent probes would be much stronger if it explained up front how these reagents are superior to or uniquely complement, add functionality, to existing ones. There are mentions of these aspects later and towards the end of the paper, but the abstract reads more like a paper introduction than a statement of the strengths of the new fluorescent proteins.

      Also, please note the endings added to two sentences pulled from the paper. Was this investigated for each of the new probes?

      Ideally, the fluorescent marker combines favorable spectroscopic properties (brightness, photostability) with specific labeling of the structure or compartment of interest **while minimally perturbing the intrinsic physiology.**

      Regardless of the application, it is crucial to use markers that show specific, crisp labeling and minimal spurious, non-specific localization **while minimally perturbing the intrinsic physiology.**

      This report/paper would be much stronger if it explained up front how these reagents are superior to or uniquely complement, add functionality, to existing ones. Quantification of stability and brightness compared to other probes would be a great addition. Characterization of the probes with tables of data would make this a stronger paper.

    1. On 2020-04-01 03:31:51, user Tom Terwilliger wrote:

      Hi Iris Young, Alexis Rohou and James Fraser,<br /> Thanks for the helpful review of the previous version! We revised the paper and uploaded this version with changes addressing your comments.

      Here are some responses to some of your specific comments (already sent them to you but posting here so that anyone can see them).

      1. The smoothed squared map procedure is used to get a mask as you note in your comments, but it is not used in the map-phasing procedure beyond that.

      2. One of your questions was about further validation. We have recently made a couple new tutorials on density modification. One takes a high-resolution apoferritin dataset and docks a homologous structure into it, fixes loops, and refines. You can run this tutorial with a script that is included. You could also edit this script if you want to use a non-density-modified map (an auto-sharpened one) and carry out the same procedure otherwise. When I do this I find that the density -modified map agrees better with both its own model and with the model from non-density-modified map than the original map does. Further the density-modified map and its model agree best. Here "agrees" means (1) set b values of a model to zero. (2) run map_model_cc on map and model and get CC_mask. This is the best example I have where density modification makes a clear difference in the final model. CC_mask values for this little experiment:<br /> analysis: <br /> denmod_map/denmod model 0.8698 denmod_map/std model 0.8461 std_map/denmod model 0.8114 <br /> std_map/std model 0.8244

      3. You can download an excel worksheet that should have the data and figures to answer some of your questions from the bioRxiv web site.

      4. If you go to the nice "full text" version of the paper on the bioRxiv site and go to Fig. S6 and click the magnifying glass then you get the plots that you request in the review of things like EMRinger scores. What you will see is that they vary, but are not improved on average by density modification. All the details are in the excel spreadsheet too.

      5. "What was the FSC improvement for the 1.8 Å map shown in Fig1C,D?"

      This is now clarified:

      D. Density-modified map. The estimated improvement in resolution where FSCref is ½ is 0.05 Å.

      1. "For the density-modified map, values of estimated Fourier shell correlation to a true map, FSC_ref, are estimated from resolution-dependent error estimates.”. This sentence makes it sound as though FSC_ref is computed not from the FSC between half maps by using eqn 1, but by some other means. Is this so? If so, please expand since FSC_ref seems everywhere else in the main text to be from eqn 1. Perhaps the authors are referring to eqn 9 here, but it is not clear why this is necessary. Why not use FSC between density-modified half maps and eqn 1?."

      This is now clarified:

      For the density-modified map, values of estimated Fourier shell correlation to a true map, FSCref, are estimated from resolution-dependent error estimates (Eq. 9, Methods). These error estimates are used so that any correlations among the two original half maps and the two map-phasing half maps can be taken into account (see Methods).

      1. Typos and clarifications fixed...in particular:

      A local weight for each set of half-maps (original half-maps, F1a, F1b and map-phasing half-maps, F2a, F2b) is then obtained as the inverse of the corresponding local variance map. These local weights are then scaled to yield an average local weight of unity and then are applied to the individual half-maps before they are averaged.

      1. The reason not to use Eq. 1, which is the standard estimate of map quality:

      FSCref =[2 FSC /(1+ FSC)]½

      at the end of density modification is that the two half-maps at this point may have some correlation (the value of A in Eq. 5b may not be zero).

      If the value of A were zero, then you could use Eq. 1. In practice... it might not make that much difference, but I have not done a systematic investigation.

      -Tom T

    1. On 2020-05-31 19:52:18, user geomcnamara@earthlink.net wrote:

      I hope the authors move fig S6 to the main text.<br /> Reference 29 "Protein-PAINT" should be cited in introduction and "independent validation" should be switched to credit their peer reviewed publication first.<br /> This paper is reminiscent of Fluorescent Speckle Microscopy (FSM, pre-super-resolution microscopy era).<br /> Note: mNeonGreen obsoleted by AausFP1 (6/2019) https://www.biorxiv.org/con... <br /> which is ~2x brighter than mNG and ~5x brighter than EGFP. Nice interactive chart on FP performance at https://www.fpbase.org/chart (I suggest starting with Y-axis Brightness, X-axis emission wavelength). One amino acid change (T203Y) would result in a bright yellow, likely similarly narrow spectra and likely very nice AausFP1green->AausFP1(T203Y)yellow spectral overlap for FRET.<br /> Triple FP ... record brightness published is V6 (Venus6, Nguyen ... Vogel 2015 PLoS One, pubmed 23152925) - Steve Vogel may have made "V8" (earlier multimers may be found in our thousand proteins of light review and data table, inside the PubSpectra zipo downloadable at https://works.bepress.com/g... ).. Some readers may also find of some use my suggestions on 'binary Tattletales' https://works.bepress.com/g... (pre-AausFP1).

    1. On 2019-01-16 04:09:28, user jeff ellis wrote:

      "In addition, VIGS mediated knock down of CHUP1 reduces stromule

      induction (8% chloroplasts with stromule(s), n = 68 images quantified) compared to

      control silencing (2% chloroplasts with stromule(s), n = 68 images quantified),

      suggesting that CHUP1 is required for pathogen induced stromule development (Fig.

      3C)".<br /> Are these numbers back to front?

    1. On 2015-07-19 04:54:03, user Davidski wrote:

      Hello authors,

      Thanks for the paper. Are those ancient genomes going to be available in Eigenstrat or PLINK formats at any stage? That would be nice.

      By the way, your PCA in which you projected the ancient genomes onto PCs computed with modern samples suffers from projection bias or space shrinkage.

      So the ancient genomes are being pulled into the middle of the plot, and that's why they cluster so close to each other.

      To avoid this problem, try running a PCA with all of the ancient genomes included and based on transversion SNPs only.

      If that's not possible, perhaps due to a lack of markers, you can try projecting the ancient samples onto PCs computed with a much larger dataset from across West Eurasia. Adding several thousand samples from all over Europe and West Asia will help to improve the results significantly.

      Cheers

      D. Wesolowski

    1. On 2021-10-07 05:29:08, user Titus Ponrathnam wrote:

      An additional question. Have you used this system with G-trace and LacZ? The 2017 paper which uses tetOff had used lacZ especially in their age related analysis, so it would be nice to attempt a few laZ stainings as a way to answer Laurent's question in older adults.

    1. On 2018-05-27 03:39:51, user Wenxi Xu wrote:

      Very interesting work! I like the IL12p40-DC migration research of your group, and i am happy to see more subsequent results. I have one small question on the ?TM-IL-12R?1, the new IL-12R?1 isoform. Correct me if I am wrong, in your previous paper published on JEM, it was shown that ?TM-IL-12R?1 enhances DC migration, but in this paper, the conclusion is ?TM-IL-12R?1 inhibits bacteria transition to medLNs and spleen. In the early stage of MTB infection, the DC migration should positively associates to bacteria transition, then how do you explain the 'conflict' between these two phenotypes?<br /> thanks!

    1. On 2020-08-13 06:05:21, user Sarah M wrote:

      Response to Etebari et al. 2020 ‘Genetic structure of the coconut rhinoceros beetle (Oryctes rhinoceros) population and the incidence of its biocontrol agents (Oryctes rhinoceros nudivirus) in the South Pacific Islands’ bioRxiv preprint doi: https://doi.org/10.1101/202...

      Sean D.G. Marshall, Sarah Mansfield, Trevor A. Jackson <br /> AgResearch, Lincoln Science Centre, Private Bag 4749, Christchurch 8140, New Zealand

      Kayvan Etebari and co-authors present genetic data that they contend supports their claims that the recent invasion of coconut rhinoceros beetle (CRB) into new areas of the Pacific was not caused by CRB-G (Marshall et al. 2017). Instead, they argue this invasion process is driven by several genetically distinct groups of CRB. A central plank to their argument is genetic analysis of the invasive CRB population found on Guadalcanal, Solomon Islands. They also present data from several countries on infection rates in CRB populations of the Oryctes rhinoceros nudivirus (OrNV) and hypothesise that OrNV has entered the invaded countries along with the invasive CRB population.

      We have serious concerns regarding the methodology used to analyse the data presented by Etebari et al., and their interpretation of the results. Previous attempts to raise these concerns with the lead author and to invite discussion of the findings with the CRB Action Group have been unsuccessful. As it stands, the preprint omits significant methodological information and fails to place their findings in the wider context of CRB invasion into the Pacific. Our concerns can be grouped under three key areas: 1) conflation of two different levels of population structure within CRB, i.e. biotype and haplotype; 2) recent research to address new CRB invasions is not taken into account, particularly in Vanuatu and the Solomon Islands; and 3) failure to prevent cross-contamination leading to artificially high ‘rates of OrNV infection’, which are not substantiated by other published techniques used to detect OrNV infection in CRB.

      Below we elaborate on these three points. We invite the authors to contact us directly regarding the concerns raised.

      1) conflation of two different levels of population structure within CRB: biotype and haplotype<br /> Marshall et al. 2017 presented genetic data that characterised different populations from the native and invasive range of CRB. In doing so, they identified a genetic marker that distinguished the newly invasive populations from older populations that arose from the initial Pacific invasion by CRB. They also presented bioassay data demonstrating that the new invasive CRB populations were not susceptible to infection by ingestion of the original strain of OrNV that was used to control the initial Pacific invasion of CRB (Huger 2005). Ingestion is the natural route of infection for OrNV so inability to infect new invasive populations is a serious concern for control of CRB. They concluded that there were four clades within the CRB populations they had sampled, with some further subdivision within each of these clades (Fig. 2, Marshall et al. 2017). Three of these clades, while genetically distinct, were all characterised by their susceptibility to the original strain of OrNV used to control the initial CRB invasion in the Pacific. These three clades included native CRB populations and populations from regions affected by the initial CRB invasion and collectively were named CRB-S. The fourth clade included CRB populations from the newly invaded regions (Guam, Papua New Guinea, Hawaii, Solomon Islands) as well as parts of the native range (Philippines, Indonesia). This fourth clade was named CRB-G. Thus, Marshall and co-authors identified two distinct levels of population structure within CRB. The first level (CRB-G and CRB-S) is associated with susceptibility to the original strain of OrNV introduced to the Pacific. The second, more complex, level reflects geographic groupings in the native and invasive range of CRB.

      Reil et al. 2018 built on this initial analysis of CRB genetics by investigating the genetic substructure of CRB in more depth, particularly in Palau, where there may have been multiple CRB invasions. They concurred that the new Pacific invasion was correlated with the presence of CRB-G. A key outcome of their paper was the use of the term ‘biotype’, i.e. conspecifics that appear similar but exhibit variation in one or more functional traits, to characterise the CRB-S/CRB-G dichotomy. This is a useful distinction to avoid confusion between this level of population structure, and the more finely divided population structure and haplotypes associated with different geographic regions.

      Etebari et al. conflate these two levels of population structure by inserting the PNG haplotype group into the CRB-S/CRB-G dichotomy. A PNG haplotype was identified by Marshall et al. 2017 and placed in Clade II, among the three clades associated with CRB-S. These specimens came from several locations in PNG known to have been affected by the earlier Pacific CRB invasions in the 1940s (Table 2, Marshall et al. 2017). The CRB-G specimens from PNG were collected solely from Port Moresby, which is presumed to be the original invasion site for CRB-G within PNG. In the Solomon Islands, CRB-G was first identified in 2015, and all field collected samples included in the analysis presented by Marshall et al. 2017 were CRB-G. We do not dispute that Etebari et al. have found CRB individuals with the PNG haplotype on Guadalcanal, but we do not support their claim that this is evidence for a separate wave of invasion into the region (see next section for further discussion).

      2) recent research to address new CRB invasions, particularly in Vanuatu and the Solomon Islands <br /> Etebari et al. report the presence of OrNV in CRB-S beetles collected from Efate, Vanuatu at some point between January and October 2019, but neither collection date nor specific locality are provided. These details are important because the presence of CRB-S was only confirmed in Vanuatu during June 2019. Our CRB-S samples collected from Mangaliliu, Efate, between June and September 2019 are negative for OrNV. In mid-September 2019, as part of the local eradication efforts against CRB, live OrNV was imported into Vanuatu. Bioassays were conducted to assess virus activity against the invasive CRB-S population and planned releases of OrNV were made on Efate in 2019 (Biosecurity Vanuatu, pers. comm.). Prior to the release of this preprint, we were unaware that these research activities in Vanuatu were likely to affect the conclusions drawn by Etebari and co-authors.

      Etebari et al. also report the presence of CRB-S and the presence of OrNV on Guadalcanal, Solomon Islands in 2019. The sampling period is stated as between January and October 2019, but again neither collection date nor specific locality are provided. The authors state that ‘the OrNV now infecting O. rhinoceros in Solomon Islands arrived with an incursion of infected O. rhinoceros that originated in Southeast Asia’. We do not dispute the presence of CRB-S in the wider Honiara region of Guadalcanal in 2019, nor do we dispute the presence of virus in the same location and at the same time, because we have independent samples that confirm their presence in Honiara in 2019. There is, however, a simpler explanation for these findings. As part of the response to the CRB-G invasion into Honiara, screening of imported live OrNV isolates for virulence against CRB-G began in Honiara during 2016 (Marshall 2016). At the same time, CRB-S beetles were brought to Honiara from the Shortland Islands (Western Province, Solomon Islands) as part of the same project. There have been subsequent imports of live OrNV to Honiara for research purposes at intervals since 2016. It is likely that the presence of CRB-S and OrNV in Honiara is due to accidental release into the local environment. This does not support the invasion hypothesis suggested by Etebari and co-authors.

      Furthermore, we note that our CRB samples from Russell Island (n = 3, Sept. 2019; n = 13, Feb. 2020; AgResearch 2020) were negative for OrNV, in contradiction to the results presented by Etebari et al. We concur with Etebari et al. that CRB populations in the New Georgia island group are negative for OrNV.

      We agree with Etebari et al. that the effect of interbreeding between CRB-S and CRB-G on OrNV susceptibility requires further investigation, particularly in Honiara, where the two biotypes now occur together outside of their native range. Care needs to be taken, however, in the assessment of OrNV infection rates (see next section).

      3) failure to prevent cross-contamination leading to artificially high ‘rates of OrNV infection’<br /> Etebari et al. present evidence of OrNV infection rates (%) based solely on PCR analysis of gut tissue samples. These tissue samples came from adult beetles captured in pheromone traps. From the information presented in the methods, it is unclear if sufficient precautions were taken to prevent accidental cross-contamination between beetles during the trapping process because the trap locations, length of time between trap set up and beetle collection, and beetle handling after collection are not described adequately. If an OrNV infected beetle is present in a trap among uninfected beetles, virus particles are easily transferred between individuals. This problem was documented by Ramle et al. 2005, who recommended careful handling of trapped beetles as a first step to minimise contamination risk. A tweet from the lead author of this preprint, dated 9 April 2019, includes a photo that shows strong potential for cross-contamination between beetles.

      It is also unclear if the PCR protocol used by Etebari et al. included an appropriate dilution step to further reduce the risk of false positives because no details of the protocol are presented. Marshall et al. 2017 recommended a 1 in 5000 dilution to improve the accuracy of OrNV detection using PCR. Furthermore, care needs to be taken to avoid accidental contamination between samples during processing. A second tweet from the preprint’s lead author, dated 18 July 2019, includes a photo that shows strong potential for cross-contamination between samples in the laboratory.

      Finally, it is common practice in insect pathology to use more than one indicator of infection, to reduce the risk of either false positives or false negatives (Lacey 2012; Vega and Kaya 2012). When assessing OrNV infection in CRB, this should include some combination of visual assessment of the gut at dissection, PCR analysis of gut tissue, preparation of histology samples to assess internal changes to the gut lining, and bioassays to determine viral virulence under controlled conditions. All of the OrNV infection rates presented by Etebari et al. are based on a single indicator, i.e. PCR analysis, with a high risk of cross-contamination, such that we consider the OrNV infection rates were overestimated significantly.

      In conclusion, we cannot support the assertion of Etebari et al. that OrNV is widespread among new, invasive populations of CRB in the Pacific. Apart from Vanuatu, which was invaded recently by CRB-S without OrNV, the new wave of Pacific invasion is dominated by CRB-G populations without OrNV (Marshall et al. 2017; Reil et al. 2018).

      References<br /> AgResearch (2020) Annex 1.1-Distribution map of CRB biotypes and virus. MFAT Progress Report WPG-0101699-DOC-4049125 (June 1, 2020).<br /> Huger AM. (2005) The Oryctes virus: Its detection, identification, and implementation in biological control of the coconut palm rhinoceros beetle, Oryctes rhinoceros (Coleoptera: Scarabaeidae). Journal of Invertebrate Pathology 89, 78-84. <br /> Lacey LA (2012) Manual of Techniques in Invertebrate Pathology (Second Edition), San Diego: Academic Press.<br /> Marshall SDG (2016) FAO Mission Report for Plant Production and Plant Protection TCP/S01/3501 – OTCP140014219: Use and production of Oryctes nudivirus to assist with control of the coconut rhinoceros beetle, Oryctes rhinoceros, in Solomon Islands (August 15, 2016).<br /> Marshall SDG, Moore A, Vaqalo M, Noble A & Jackson TA (2017) A new haplotype of the coconut rhinoceros beetle, Oryctes rhinoceros, has escaped biological control by Oryctes rhinoceros nudivirus and is invading Pacific Islands. Journal of Invertebrate Pathology 149, 127-134. <br /> Ramle M, Wahid MB, Norman K, Glare TR & Jackson TA (2005) The incidence and use of Oryctes virus for control of rhinoceros beetle in oil palm plantations in Malaysia. Journal of Invertebrate Pathology 89, 85-90. <br /> Reil JB, Doorenweerd C, San Jose M, Sim SB, Geib SM & Rubinoff D (2018) Transpacific coalescent pathways of coconut rhinoceros beetle biotypes: Resistance to biological control catalyses resurgence of an old pest. Molecular Ecology 27(22), 4459-4474. <br /> Vega FE & Kaya HK (2012) Insect Pathology (Elsevier Science).

    1. On 2022-09-22 18:25:45, user john wallingford wrote:

      The paper also has me thinking about patterns of cytoplasmic mechanics. Microheology shows that cytoplasmic stiffness differs in different regions of migrating cells. How do such patterns relate to the propagation of forces at the cortex/membrane?

    1. On 2017-06-05 21:35:17, user Paul Katz wrote:

      You might be interested in an old paper that looks at female preference in hybrid crickets.<br /> Hoy RR, Hahn J, and Paul RC. Hybrid cricket auditory behavior: evidence for genetic coupling in animal communication. Science 195: 82-84, 1977.

    1. On 2024-12-14 15:21:00, user Stephanie Wankowicz wrote:

      This publication aims to develop a platform of methods to identify small molecule ligand and RNA substrate interactions. Using a library of coumarin derivatives, they discovered a small molecule, C30, with high affinity binding to RNA single G bulges over other bulges (A, U, and C). The authors used Gaussian accelerated Molecular Dynamics (GaMD) simulations to study interactions, NMR to confirm the binding site location, and lasso regression to identify molecular descriptors for structure-activity relationships. The other narrative in this paper argues that this methodology could be used to develop better RNA-small molecule ligands for therapeutic purposes. <br /> Major Revisions:<br /> To strengthen the novel aspects of the authors' methodology, it would be beneficial to add context on why this method is more advantageous than previous workflow paths. <br /> Additionally, to drive this home in the conclusion, it would be beneficial to summarize the novel nature of this workflow and how it was used to discover these new ligands.<br /> We suggest clarifying and justifying the type of RNA substrate used in each assay (ssRNA, dsRNA, etc.). For example, we suggest clarifying if the modeled version of “SL5RNA” used in the Fig 2 in vitro assay is the same as the additional FP simulations. <br /> For Fig. 3, in these FP simulations, please clarify if this “DNA version” of the RNA5 and RNA1 substrains is dsDNA or ssDNA. If it is a helical dsDNA version of the substrate, a justification as to why this was used to probe a minor groove binding mechanism for a seemingly bulged ssRNA substrate would be beneficial.<br /> We would suggest integrating some of the supplementary figures, like Supplementary Figure 6, into the main text. This could enhance the reader's understanding of the electrostatic interactions in RNA-ligand binding and the significance of Ring A's positive charge in identifying binding pockets. <br /> Additionally, we suggest exploring alternative feature selection methods such as SHAP or Markov trees. These could potentially capture more nuanced, nonlinear interactions that might be missed by a linear selection method like LASSO.<br /> Minor Revisions:<br /> In the introduction, we suggest that the authors clarify the importance of preventing deep hydrophobic binding pockets in a pharmaceutical context, including a more streamlined discussion of coumarin derivatives and their therapeutic potential for SARS-CoV-2.<br /> We suggest in Fig. 2D that the graphs’ y-axes should be scaled the same and these curves should be labeled “GA-rich” and “G” for clarity. <br /> For Fig. 3A, we suggest the legend be enhanced and a scale bar added for clarity. <br /> For Fig 3D, it is difficult to identify the yellow, grey, and orange dashed lines. Please make this more obvious to highlight.

    1. On 2021-09-19 08:44:21, user Aliaksei Chareshneu wrote:

      In case of questions, comments or any other correspondence, please use the following email address: 479052@mail.muni.cz. Unfortunately, the corresponding author of this pre-print, professor Jaroslav Koca, recently passed away.

    1. On 2024-07-12 14:18:11, user Prof. T. K. Wood wrote:

      1. DarT/DarG is better characterized as a type V TA system; this category is based on the fact that antitoxin DarG is an enzyme but does not alter the toxin (type VII). The first member of this group is GhoT/GhoS (please cite doi: 10.1038/NChemBio.1062).

      2. Toxin/antitoxin systems were first shown to inhibit phage in 1996 (please cite doi: 10.1128/jb.178.7.2044-2050.1996).

    1. On 2023-09-07 17:31:29, user AL wrote:

      Thank you for presenting the importance of information leakage and being intentional with how to split the data.

      There are a few typos that I wanted to bring to your attention: <br /> - top of pg 4, awkward phrase with 2 already's<br /> - first sentence of pg 6, compile instead of complie<br /> - pg 7, splitting was spelled as spitting<br /> - bottom of pg 7, "to evaluation"

    1. On 2018-01-25 20:11:24, user Heather Bruce wrote:

      This comment was posted a few versions back and isn't showing up here, but I think the discussion is important, so I'm reposting it.

      SPXR said:<br /> Two shortcomings are: (1) lack of explicit comparison of the "large" and "small" plates of Oncopeltus with respect to the pleurae of other insects, and (2) assumption that the abdominal appendages of insects and other Pancrustacea are uniramous. With respect to 1, the pleurae of insects comprise the two pleural arcs (coxosternite: trochantin, precoxa; anapleurite: episternum, epimeron), as defined by Snodgrass (1935, Fundamentals of Insect Morphology). It is frustrating to read a paper making claims about the "body wall" of insects without ever using the term "pleuron", which appears to betray lack of comparative morphological knowledge. That said, shortcoming 2 above is less grievous, but still disheartening: The authors claim that the abdominal styli of Archaeognatha and Zygentoma are epipods, apparently forgetting that the abdominal appendages of Pancrustacea are biramous, with an endopod ("telopod") and exopod, with a number of protopodal epipods.

      Please pardon the tone of this message. The work is very encouraging for the resolution of leg and pleural homologies overall!

      My response:<br /> Thank you for your comments, I’m very happy for the opportunity to discuss this!

      Regarding (1), we made a decision to remove as much jargon as possible so that the paper would be accessible to a wide audience. As you are probably aware, insect and crustacean morphology nomenclature can be quite daunting, and we didn’t want to lose the reader at Figure 1! In the original version of the manuscript, I went with the terms in Snodgrass 1927, where he makes a nice case for the insect subcoxa theory. So, I homologized the crustacean coxa with the insect trochantin, and the crustacean precoxa with the insect epimeron/episternum. Terminology aside, another reason not to use the insect nomenclature is that there may not be terms that correspond precisely to the ancestral crustacean structures. For example, the epimeron/episternum might only represent the lateral/pleural portion of the precoxa leg segment that was incorporated into the insect body wall, but the precoxa might also include a portion of the notum, above and adjacent to the wing. Another issue was that I did not come across a term that distinguishes the body wall part of the trochantin from the plate-like outgrowth of the trochantin, which extends over the insect coxa. It was important to distinguish these two regions, because only the plate-like outgrowth of the trochantin is deleted following the loss of wing/epipod genes (Clark-Hachtel 2013, Ohde 2013, Medved 2015, Wang, 2017), and therefore it was to this region only that I homologized the crustacean coxal epipod. Our solution to these problems was to use pictures and plain language to show our homology schema. However, I’m happy to wade into the jargon weeds with you here :)

      As you probably know, “biramous” refers to a leg with an exopod, while “uniramous” legs lack an exopod, but may have epipods and endites (Boxshall 2004, Boxshall 2009). Regarding your point (2), we do not claim that the abdominal appendages of Archaeognatha or Pancrustacea are uniramous (Parhyale abdominal appendages are quite biramous, as are the thoracic and/or abdominal appendages of many crustaceans). From our manuscript, “the thoracic stylus of jumping bristletails (Fig. 4, st) is the epipod of the crustacean basis”. From a morphological standpoint, Tiegs 1940 says that Archaeognathan thoracic styli are unsegmented, and do not have intrinsic musculature, which are hallmarks of epipods (Boxshall 2004, Boxshall 2009). In contrast, the abdominal styli, while they may or may not be segmented (Matsuda 1976 vs Staniczek 2014), apparently have intrinsic musculature (Matsuda 1976, Matsuda 1957, Tiegs 1940), which suggests that they are exopods (Boxshall 2004, Boxshall 2009). However, since thoracic and abdominal styli both emerge from the insect coxa/crustacean basis (our manuscript, and following discussion), it is somewhat curious if they are not homologous structures. I certainly welcome any good sources you may have on this subject!

      Basal hexapods aside, a more satisfying answer regarding the identity of the lateral nubs of insect embryonic abdominal appendages lies in a comparison of Sp6-9/btd and Dll expression. The crustacean basis/insect coxa expresses Sp6-9 and btd (our manuscript). It carries the exopod and endopod, which each express Dll (Fig. S1, Hejnol 2004, Williams 2002, Panganiban 1995). Thus, if insect abdominal appendages had exopods, they should express Dll. However, most insects do not express Dll in the abdomen (this is why many molecular researchers didn’t know that insects form abdominal appendages as embryos and regarded them in adults as novel structures). While Dll, and thus exopods, are not expressed in insect A2-8, there are paired, leg-like domains of btd expression on each abdominal segment of some insects (Schaeper 2010), which, according to our leg segment homology model (Fig. 4), suggests that these appendages are comprised of three leg segments: the precoxa (pink), crustacean coxa (red), and insect coxa (orange, expresses Sp6-9/btd), but not the trochanter (yellow, expresses Dll). See also the beautiful SEM images of the lateral nubs of the embryonic abdominal appendages in terrestrial carabid beetles in Kobayashi 2013 compared to the gills in aquatic carabid beetles in Komatsu 2012. Komatsu 2012 note that the gills of the aquatic beetle do not develop from the insect coxa, but from a proximal region, the subcoxa, which fuses to the body wall. This is most apparent by examining the nub/gill of the A1 pleuropod, which emerges from a position proximal to the insect coxa. Notably, the A1 pleuropodia, which is longer, expresses both Sp6-9/btd and Dll at the tip, while the A2-8 appendages, which are shorter, express only Sp6-9/btd (Schaeper 2010, Beerman 2004, Beerman 2001, Rogers 2002). This is explained by our model (Fig. 4): the longer A1 pleuropod is comprised of at least four leg segments (precoxa, crustacean coxa, insect coxa, trochanter) expressing both Sp6-9/btd and Dll, while the shorter A2-8 appendages have three leg segments (precoxa, crustacean coxa, insect coxa), expressing only Sp6-9/btd. Since the A2-8 appendages do not express Dll, they do not have exopods, and cannot be considered biramous.

      We are planning to submit this manuscript to a journal soon, and due to space limits, we could not include as much of the background supporting information as we would have liked. However, I am currently writing a review that more fully discusses the morphological, molecular, and embryological evidence for the model we propose in this manuscript. I hope this was helpful :)

    1. On 2020-01-24 13:09:06, user Yen Shu Chen wrote:

      The authors did not share (no GenBank/GISAID accession number are provided) the genome sequence of the critical bat-CoV that represents a close relative to human 2019-nCoV. <br /> No way to access/reproduce/further use their result. Do scientific journals accept such practice?

    1. On 2022-09-30 22:29:46, user MIT Microbiome Club wrote:

      Small things: S6, S7,... There's a typo in multiple figures, "Addative". The sign of Figure 4D and E might be reversed. In Methods "rfc" is supposed to be "rcf". The author's point could be strengthened by mentioning the RMSE of the trio models in the text (rather than just in the Figure), as was done for the pair models. Figure 3A is a little confusing regarding the relationship between all the bar graphs-- could be useful to add an "=" before the 4th bar graph in each series so show what each model predicts the outcome to be.

    1. On 2018-11-09 06:45:27, user Wendy Adams wrote:

      "Long-term use of antibiotics is associated with serious complications, including post-treatment Lyme disease syndrome (PTLDS)."<br /> Unclear what this means - if it means that LT abx cause PTLDS, then that's not a true statement. LT antibiotics may be prescribed for PTLDS (or chronic Lyme) but PTLDS by definition is dx'ed after a standard course of doxy or amox, not a long course, of antibiotics. You may have meant "PTLDS may be treated with LT abx, which may be associated with serious complications". Also important to remember that PTLDS is only a small subset of those patients who are still symptomatic after initial treatment for Lyme disease.

    1. On 2015-01-17 16:16:44, user Guest wrote:

      This is a copy of the communication from May 2014 that the authors refer to in their paper:


      Subject: Re: Mbd3 and Reprogramming<br /> From: Jacob Hanna jhannawis@gmail.com<br /> Date: May 24, 2014 at 8:36:20 PM GMT+3<br /> Cc: Jose Silva jcs64@cscr.cam.ac.uk, Paul Bertone bertone@ebi.ac.uk<br /> To: Brian Hendrich brian.hendrich@cscr.cam.ac.uk

      Hi Brian,

      Thanks for the comments. Throughout the study and as we had been working on this since 2010 we have extensively used three reporters to mark naive pluripotency - Oct4-GFP complete transgene, delta-PE Oct4-GFP transgene and Nanog-GFP knock-in cells (Figure 2). All systems were made from WT and Mbd3 flox/- cells and confirmed matching results. In case of random transgenes, we always validated specific activation in bona-fide iPS/ESCs and not in differentiated cells in vitro or teratomas. We have used multiple Mbd3 depleted clones and multiple wild-type clones to make sure we are covering different stoichiometries. Please also note that we have also conducted Mbd3 reconstitution with Wt and mutant vectors as indicated in the study on Mbd3 flox/- cells. Imaging analysis was done on both types of Oct4-GFP reporters because they are the brightest and allow detection at 5X resolution of entire wells. We have also conducted in single cell well assays, confirming staining for Nanog when it was not used as a reporter. I am extremely confident of the up to 100% iPSC formation one can get, as modestly speaking, i have experience with validating iPSCs. The WT cells in our reprogramming conditions never gives us higher than 20% form somatic cells. As our paper indicates, there could be NuRD independent ways to get deterministic reprogramming, as apparently is the case of C/EBPa in pre-B cells published by Thomas Graf.

      At the times reviewer were debating which is the best marker, Oct4 or Nanog and so on, but to me the best argument is harvesting cells after 8 days of DOX without any passaging and sorting and seeing chromatin and transcription that is indistinguishable from ESCs/iPSCs. This is evident from our published data and not form WT cells even after longer days on DOX (11 days). As I have emailed u 2 months ago but u preferred not to discuss, we can map at high resolution reprogramming by harvesting secondary Mbd3 flox/- cells every 24 hours until day 8 ( RNA-seq, DNA methylation, ATAC-seq etc), and the cells completely reprogram to naive pluripotency (again wihtout sorting, passaging or any kind of biasing..but not from our most efficient wild type cells).

      Our data are consistent with Grummt paper that NuRD activity blocks somatic cell reprogramming, and consistent with your publication that Mbd3 -/- cells are hyper-pluripotent (Reynolds 2012 CSC.) We do not believe in authentic differences in a factor promoting maintenance of naive pluripotency but blocks induction of pluripotency, unless the experiments are done in such a way to disrupt somatic cells in such a harsh manner that they can no longer be reprogrammed. e.g. Harsh and early depletion/inhibition of DNMT1 or ERK1/2 can lead to apoptosis and loss of proliferation of somatic cells or EpiSCs if done sub-optimally and in absence of adequate and rapid OKSM expression and rich naive conditions, and lead to a distorted of context dependent promotion of iPSC formation by these factors.

      Finally, we have accumulated great mechanistic data on NuRD activity and manipulation leading to deterministic reprogramming, and in new systems completely not related to your cell lines, hopefully to be published soon.

      Cheers,<br /> Jacob


      On May 23, 2014, at 4:37 PM, Brian Hendrich brian.hendrich@cscr.cam.ac.uk wrote:

      Dear Jacob,

      I am writing to ask your comments on a technical aspect of your Nature study, showing 100% reprogramming efficiency of MEFs upon depletion or deletion of Mbd3 (Rais et al. (2013).

      We downloaded the ChIP-seq data to see how various changes are manifested in the iPS cells, which might point to how such efficient reprogramming can be facilitated by the lack of a functional NuRD complex. When we looked at the data, we saw a pronounced over-representation of reads at the Oct4 locus in both the ChIP and input (“Whole Cell Extracts”) samples. Similar read density was not found at other pluripotency-associated gene loci (e.g. Nanog or Esrrb), nor was it seen for the other reprogramming factors Myc, Sox2 or Klf4. Rather, this readout appears to correspond to your Oct4 promoter transgene construct (it is around 18kb, please see the attached genome browser figure).

      There are two aspects that we are confused about. First, the read counts are very high above background, indicating the presence of many transgene copies in the cells that were transformed. It isn't entirely clear from the main text of your paper, but how exactly were these made? Did you use the same lentiviral transduction method as was used for the reprogramming factors, and did you attempt to characterize the integration sites? With so many copies (at least 15-20) it becomes likely that one or more could be expressed under the control of a different regulatory element, activating GFP independently of endogenous Oct4 upregulation.

      A second issue came up when we compared the ChIP-seq tracks from the Mbd3fl/- and WT MEFs. In the Mbd3fl/- cells, which apparently reprogram very easily, the entire Oct4 promoter locus is represented. That is expected. However in your WT cells, which were reported as being more refractory to reprogramming, a gap is evident in the read coverage spanning the Oct4 proximal enhancer (PE) element.

      It therefore seems that the two cell lines were transformed with different reporter constructs: the Mbd3fl/- MEFs received a construct containing the full Oct4 promoter sequence, whereas the WT MEFs were transformed with a different version where the PE is missing. Note that this is not due to lack of sequencing depth, as the WT cells actually have more reads (33-50M reads) than the Flox/- cells (10-33M reads). If anything was present in this region it would have been detected.

      The PE element is the most highly conserved region of the Oct4 promoter; the absence of this sequence in your negative/control cells would lead them to activate GFP expression much less efficiently and with slower kinetics than the Mbd3fl/- (positive) cells. Combined with the apparent high number of transgene insertions that may lead to misregulation of the Oct4-GFP reporter when the full promoter sequence is present, we are concerned that these effects could lead to an erroneous conclusion that cells lacking NuRD activity display more efficient reprogramming.

      We feel that these are both serious issues which could potentially undermine the main conclusions of your paper. Could you please let us know what you make of these observations, and whether you can reassure us that the findings in Rais et al. are still sound?

      Thank you very much for your assistance.

      Yours Sincerely,

      Brian Hendrich<br /> Paul Bertone<br /> Jose Silva

      Wellcome Trust - MRC Stem Cell Institute<br /> Department of Biochemistry<br /> University of Cambridge<br /> Tennis Court Road<br /> Cambridge<br /> CB2 1QR<br /> United Kingdom

      www.stemcells.cam.ac.uk

    1. On 2019-11-20 17:31:12, user Connor Rosen wrote:

      I thank the authors for this investigation and I am excited by the potential of this analysis. However, without the full gene expression information it is difficult to fully understand the role of Langerhans cells and the impact of their absence. The authors should provide the full data (e.g. tables of differentially expressed genes in each cell type), and the accession number for the underlying RNA-seq data for re-analysis.

    1. On 2022-12-02 07:44:58, user Andrzej Dziembowski wrote:

      mRNA vaccines against COVID-19 have revolutionized vaccinology and have been administered in billions of doses, demonstrating their safety and effectiveness (I was also vaccinated with the mRNA vaccine). Our data provide another reason why they are so effective.

    1. On 2025-05-07 00:51:43, user Young Cho wrote:

      Non-Invasive dsRNA Delivery via Feeding for Effective Gene Silencing in Teleost Fish: A Novel Approach in the Study of Gene Function Analysis <br /> Reviewer in Chief: Branndon Evans <br /> ? Summary <br /> ? Introduction <br /> ? Results <br /> ? Discussion <br /> ? Overall takeaways <br /> As an emerging professional in aquaculture biotechnology, I found this paper to be very fascinating. Your research is quite novel and brings interesting implications for the further development use of RNA biotech in aquaculture. <br /> Summary <br /> Summary: This paper demonstrated a novel approach of feeding fish E.coli engineered to express double-stranded RNA (dsRNA) as a vector. The authors demonstrated that non-invasive dsRNA delivery via feeding technique can knock down the dnd gene during PGCs migration and differentiation in S. schlegelii. The authors demonstrated that transformed E.coli vectors can be combined with rotifers, brine shrimp and dry feed to serve as an effective means of introducing dsRNA. <br /> Introduction <br /> A comprehensive review and introduction on the topic was given. Objective was clearly stated and achieved. <br /> Materials & Methods <br /> Methods are straightforward and easy to follow. Someone who is not necessarily an expert in aquaculture or RNAi technology would be able to understand how this experiment was conducted. Methods are put in succinct and desirable detail. The inclusion of a figure to represent the construct generated did enhance the section but would have benefited from a caption rather than representation at the end of the paper. Including supplementary material on primers specific sequence would also be good to add for improved reproducability. <br /> Results <br /> The results of this experiment were very interesting. An approximated 50% of fish displayed dysplasia in their gonads. Insinuating that a large number of these fish would be infertile. Taking off target effects into account would have been useful, but did not seem to be tested for in this experiment. I viewed your paper on biorxiv, so this may have contributed to formatting issues, but I found it difficult to interpret some figures because they were displayed at the end of the article without an explanatory paragraph. This made full interpretation difficult and required<br /> heavier interpretation by the reader. You explain your results in the discussion which allows an attentive reader to understand the results. <br /> Discussion <br /> The significance and relevance of your results are clearly explained. The value not only in scientific but also commercial realms is illuminated to draw maximum There is some conjecture that the gonads in the fish are ideal candidates for germ cell transplantation. However it is not clear that these gonads would be functional, especially considering the dysplasia and sex reversal observed in many individuals. In lines 462 through 463, describing these fish as ideal recipients for PGCs is dubious due to seemingly described gonad dysfunction and deformity. Further exploration on how gonads could be made useable would help to backup this view. <br /> Figures <br /> Some issues in viewing the figures may be due to the nature of how I viewed the document, however the imaging of gonads would have benefitted from additional explanation. Comparison between normal and altered gonads would have made the significance of these images more understandable. Tables (a) & (b) lacked a nearby description which made interpretation difficult. A way to demonstrate recorded effects over sampling time in a table or graph would have been favorable as well. Also including a figure categorizing gonad manifestation would have been useful. <br /> References <br /> They are well arranged, easy to understand and suitable for this paper. <br /> Overall Review <br /> This paper presented very novel techniques and had fascinating results. Someone with adequate technical skill could replicate this experiment. I wonder if this can be applied to the more efficient creation of transgenic organisms, vaccine delivery and other benefits. I look forward to reading about more applications of this research. <br /> Thank you for your time, <br /> Mahalo, Sincerely Branndon Evans

    1. On 2025-03-18 19:59:26, user Brett Pike wrote:

      Hello, thank you for sharing this mountain of data. In my preliminary evaluation I find that the orientation of the chromosomes is not standardized, i.e. about half need to be reverse complemented. I am writing to ask that you fix this, and I suggest using the orientation from cs10. ntSynt-viz with '--normalize' flag I find to be the simplest visualizer for this task. Thank you!

    1. On 2021-03-26 07:44:31, user Jorg Tost wrote:

      Please note, that the annotation files have been updated to the latest genome versions for the rhesus macaque in the final published version in Epigenomics. The article published in Epigenomcis is freely available.

    1. On 2015-10-09 23:52:59, user David Basanta wrote:

      This paper is part of a series done for the NCI (the ICBP and PSOC initiatives), it's not peer review nor original research but an example of how evolutionary game theory could be used to study various aspects of cancer progression.

    1. On 2021-02-21 10:44:49, user Stuart Cook wrote:

      Very nice manuscript. For the link to IL11, I think the references below would be much stronger as they relate to cardiac fibrosis/fibroblasts whereas the current reference (16) is specific to lung. Happy to help with IL11-related follow on experiments, if useful.

      Schafer et al. 2017. “IL-11 Is a Crucial Determinant of Cardiovascular Fibrosis.” Nature 552 (7683): 110–15.

      Lim, Wei-Wen, et al 2021. “Antibody-Mediated Neutralization of IL11 Signalling Reduces ERK Activation and Cardiac Fibrosis in a Mouse Model of Severe Pressure Overload.” Clinical and Experimental Pharmacology & Physiology, January. https://doi.org/10.1111/144....

      Corden, Ben, et al. 2020. “Therapeutic Targeting of Interleukin-11 Signalling Reduces Pressure Overload-Induced Cardiac Fibrosis in Mice.” Journal of Cardiovascular Translational Research, June. https://doi.org/10.1007/s12....

    1. On 2015-11-30 14:55:42, user Raphael Levy wrote:

      PNAS rejected the letter: "After careful consideration, the Board has decided that your letter does not contribute significantly to the discussion of this paper." (https://raphazlab.wordpress... "https://raphazlab.wordpress.com/2015/11/16/pnas-your-letter-does-not-contribute-significantly-to-the-discussion-of-this-paper/)")

      More info on our work and analysis of SmartFlare can be found at my blog (https://raphazlab.wordpress... "https://raphazlab.wordpress.com/tag/smartflare/)").

    1. On 2018-06-23 10:11:09, user Collin Ewald wrote:

      Since Insulin/IGF-1 signaling also regulates axon regeneration and the extracellular domain of APL-1 has been shown to mediated several processes such as development, learning, and aging through DAF-16, have you considered that APL-1EXT regulates axon regeneration through DAF-16?

    1. On 2018-10-25 01:36:05, user Ajay Singh wrote:

      In this paper authors have developed quinazoline derivative and analyze the efficacy against Aspergillus fumigatus. The number of the tested strains is sufficient to draw general conclusions. the authors have cited adequately references for the assays used in the study. The introduction is relevant. Sufficient information about the previous study findings is presented for readers to follow the present study rationale and procedures. The results appear to be valid and the methodology is appropriate. English language needs to correct and need to add one more figure related to microscopic examination of spore in control and treated with compound.

    1. On 2023-10-27 19:33:35, user Federico wrote:

      The claim that you have generated brown adipocytes is overstated. There is no clear proof morphologically or by significant changes in gene expression (UCP1) that would support brown adipocyte character. I would revisit that experiment.

      Showing tissue that has formed (and analyze it histomorphological) would make the in vivo work much more convincing. In line with that, survival for up to 28 weeks seems overstated as IVIS data thresholding doesn't seem to be corrected for background noise.

    1. On 2016-11-02 21:06:32, user Mike Weale wrote:

      Apologies to all interested parties! The title of this paper is missing a crucial negative! The title should be: "True causal effect size heterogeneity is not required to explain trans-ethnic differences in GWAS signals". We will correct ASAP. Mike Weale & Daniela Zanetti

    1. On 2016-06-24 04:02:20, user A.Folg wrote:

      I'm trying to find "PF7466" position: 13904842 within the y-chromosome of the sample I1707 but only can find this position tested within chromosome 1. Positive SNPs only give us IJK for this sample and anyway is negative for all known main T subclades T1a1, T1a2 and T1a3a.

    1. On 2017-05-29 01:27:40, user jotan wrote:

      This is a useful guide which I would like to share with my students. Unfortunately, the students who need this the most, also have the poorest English skills.

      It would be very helpful if the authors could apply some principles of "Plain English campaign" (https://en.wikipedia.org/wi... "https://en.wikipedia.org/wiki/Plain_English_Campaign)") to make this article more accessible to people who use English as a second language.

      For example:

      "Clear communication is also crucial for the broader scientific enterprise because ‘concept transfer’ is a rate-limiting step in scientific cross-pollination."

      This is a nicely crafted sentence for scientists who are fluent in English but is virtually unreadable for someone struggling with English. "Rate-limiting step" and "cross-pollination" restricts the audience.

      I would also recommend that the authors consider substituting rarely-used words with more common versions wherever possible.

      "credible" -> believable<br /> "chronological path" -> timeline<br /> "exposition" -> explanation<br /> "cognition" -> thinking<br /> "paramount" -> most important

      etc.

    1. On 2021-04-09 22:39:45, user kdrl nakle wrote:

      I don't trust your research at all. You concluded that 30% Ethanol is effective while 80% is not (or a lot less). This contradicts all the researches previously. You did not bother one iota to explain this huge elephant in your paper. By the way, your graphs lack clarity.

    1. On 2020-04-08 13:26:50, user Scott Nichols wrote:

      Excellent findings! A quick questions and two comments from our lab meeting discussion:

      Question -The integrin-blocking antibody was assayed for adhesion phenotypes on a fibronectin (Mammalian origin?) substrate. Does it also disrupt filopodial attachment to uncoated glass slides, on which Capsaspora is presumably attaching to its endogenously secreted substrate? Just wondering if Capsaspora integrins 'normally' adhere in the same way as animal integrins.

      Comment 1. The vinculin staining is certainly punctate, but doesn't seem particularly co-localized with integrin in most places on the filopodia. It is possible that the vinculin that isn't co-localized with this integrin could be bound to attachments that use other integrins. Might be nice to show the co-localization quantitatively. Were there no co-precipitates in the IP's?

      Comment 2. We were all very curious to see some low-exposure images to see what the integrin and vinculin staining looked like in the cell body. Any idea why there might be high levels in the cytosol of the cell body (or perhaps it is also membrane localized there?). Is it punctate or diffuse, localized with actin filaments?

      Comment 3. "Vinculin" in Capsaspora is definitely a VIN-family member, but isn't a vinculin orthology. Vinculin, alpha-catenin, alpha-catenin-like and alpha-catulin proteins in animals are all more closely related to each other than any are to non-animal family members. It might be worth clarifying this distinction.

      Anyway, really cool paper and finding. Just wanted to let you know the questions that came up.

    1. On 2016-06-23 17:12:34, user Justyna Hobot wrote:

      "@anilkseth: TMS to prefrontal (or parietal) cortex does NOT impair visual metacognition, new @sacklercentreled by @DanielBor https://t.co/LnHE3DRtL5."

      Dear Authors, how would you rate your awareness that the quoted sentence is just a catchy overstatement? I allow myself to post some comments on the paper, I hope this might be helpful.

      1. "An advantage of TMS, besides its non-invasive nature, is that TMS-induced changes are limited to short time periods so that plasticity is unlikely to affect performance."

      Didn’t you apply TMS in order to induce the plasticity-like changes that affect cognitive performance?

      1. "First, continuous theta burst TMS (cTBS) was used instead of repetitive TMS."

      Continuous Theta Burst Stimulation (cTBS) is an example of repetitive TMS. Repetitive TMS simply means it has a precise temporal pattern of pulses, and cTBS has the precise temporal pattern of pulses (see e.g. Bergmann 2016 or Oberman 2011).

      Bergmann, T. O., Karabanov, A., Hartwigsen, G., Thielscher, A., & Siebner, H. R. (n.d.). Combining non-invasive transcranial brain stimulation with neuroimaging and electrophysiology: Current approaches and future perspectives. NeuroImage. http://doi.org/10.1016/j.ne...<br /> Oberman, L., Edwards, D., Eldaief, M., & Pascual-Leone, A. (2011). Safety of Theta Burst Transcranial Magnetic Stimulation: A systematic review of the literature. Journal of Clinical Neurophysiology, 28(1), 67–74. http://doi.org/10.1097/WNP....

      1. "This technique involves a very rapid sequence of TMS pulses, typically for 40 s, and is thought to suppress cortical excitability for up to 20 minutes (ref. 19)"

      "thought to suppress cortical excitability" – the 40 s cTBS may suppress M1 excitability, as long as it is applied correctly and the basal state of the brain allows such changes to occur, but e.g. the change of current direction can reverse inhibition to facilitation (see e.g. Jacobs 2012), and the short version of cTBS (like the one used by you) may actually increase M1 excitability, if there is no prior voluntary motor activation (see e.g. Gentler 2008).

      "for up to 20 minutes" – you referred to Huang 2005, where the motor cortical excitability after the 40 s of cTBS was suppressed for 60 min. The after-effects lasting up to 20 minutes were also reported, but after 20 s (not 40 s) of the cTBS. Therefore, there is no need to confuse the reader by writing: "TMS pulses, typically for 40 s, and is thought to suppress cortical excitability for up to 20 minutes".

      Jacobs, M. F., Zapallow, C. M., Tsang, P., Lee, K. G. H., Asmussen, M. J., & Nelson, A. J. (2012). Current direction specificity of continuous ?-burst stimulation in modulating human motor cortex excitability when applied to somatosensory cortex. Neuroreport, 23(16), 927–931. http://doi.org/10.1097/WNR....<br /> Gentner, R., Wankerl, K., Reinsberger, C., Zeller, D., & Classen, J. (2008). Depression of human corticospinal excitability induced by magnetic theta-burst stimulation: evidence of rapid polarity-reversing metaplasticity. Cerebral Cortex (New York, N.Y.: 1991), 18(9), 2046–2053. http://doi.org/10.1093/cerc...<br /> Huang, Y.-Z., Edwards, M. J., Rounis, E., Bhatia, K. P., & Rothwell, J. C. (2005). Theta burst stimulation of the human motor cortex. Neuron, 45(2), 201–206. http://doi.org/10.1016/j.ne...

      1. "In this way, TMS administration can be entirely separated from the behavioural task, and therefore will not distract the participants from it."

      It may be worth to note that what happens just after applying cTBS may reverse its after-effects (see e.g. Huang 2008), which means the first minutes of performing the post-TBS block may influence the effects observed on the following part. Did you try to check, how consistent the task performance was, by comparing the first 150 trials with the second half of the block?

      Huang, Y.-Z., Rothwell, J. C., Edwards, M. J., & Chen, R.-S. (2008). Effect of physiological activity on an NMDA-dependent form of cortical plasticity in human. Cerebral Cortex (New York, N.Y.: 1991), 18(3), 563–570. http://doi.org/10.1093/cerc...

      1. "In addition, a small (n=7) patient lesion study showed that the anterior prefrontal cortex (i.e. a region neighbouring the DLPFC) selectively impaired perceptual metacognition, though not memory-based metacognition, compared with patients who had temporal lobe lesions (27)."

      You may check Del Cul 2009 paper, which also indicated the involvement of aPFC in perceptual metacognition, and the study was conducted on a bigger group of patients (n=15) than the one you refer to. Moreover, McCurdy 2013 showed that variation in visual metacognitive efficiency in his study was correlated with volume of frontal polar regions, while the variation in memory metacognitive efficiency with volume of the precuneus. However, I wonder, how this should support the use of DLPFC, instead of aPFC? Only because it is a neighbouring region?

      Cul, A. D., Dehaene, S., Reyes, P., Bravo, E., & Slachevsky, A. (2009). Causal role of prefrontal cortex in the threshold for access to consciousness. Brain, 132(9), 2531–2540. http://doi.org/10.1093/brai...<br /> McCurdy, L. Y., Maniscalco, B., Metcalfe, J., Liu, K. Y., Lange, F. P. de, & Lau, H. (2013). Anatomical Coupling between Distinct Metacognitive Systems for Memory and Visual Perception. The Journal of Neuroscience, 33(5), 1897–1906. http://doi.org/10.1523/JNEU...

      1. "In experiment 1 we therefore sought to replicate the Rounis study, as well as extend it to the posterior parietal cortex, since this region in neuroimaging studies is very commonly co-activated with DLPFC".

      What do you mean when saying "this region"? PPC is an area, big enough to be consisted of subregions that have a different cytoarchitectonics, a different pattern of structural connectivity, and the activity of these subregions may correlate in a different way with the activity in different subregions of DLPFC (e.g. Leech 2011). The same of course applies to DLPFC (see e.g. Optiz 2016 for comparison of distinct DLPFC stimulation zones with respect to functional networks).

      Leech, R., Kamourieh, S., Beckmann, C. F., & Sharp, D. J. (2011). Fractionating the Default Mode Network: Distinct Contributions of the Ventral and Dorsal Posterior Cingulate Cortex to Cognitive Control. The Journal of Neuroscience, 31(9), 3217–3224. http://doi.org/10.1523/JNEU...<br /> Opitz, A., Fox, M. D., Craddock, R. C., Colcombe, S., & Milham, M. P. (2016). An integrated framework for targeting functional networks via transcranial magnetic stimulation. NeuroImage, 127, 86–96. http://doi.org/10.1016/j.ne...

      1. "Furthermore, we attempted to enhance the original Rounis design, by including an active TMS control (vertex), rather than sham stimulation."

      Is there any reason to assume that by applying 2 times the same protocol to the same site (600 pulses to the vertex) you control for the effects of applying the same protocol to two different sites (300 pulses to each site)?

      1. "We were concerned that managing the relative frequency of subjective ratings of "clear" and "unclear" labels across an experiment may have placed additional working memory demands on participants, since they would need to keep a rough recent tally of each rating in order to balance them out. In addition, these labels were difficult to interpret psychologically on account of their relative nature. We therefore opted instead for the labels "[completely] random [guess]" and "[at least some] confidence." Using confidence instead of clarity labels is a common practice, consistent with other recent metacognition studies (24, 25)."

      What do you think about a possibility that by replacing the introspective report with a different kind of metacognitive report you investigated a different phenomenon/underlying processes than Rounis 2010 did (see e.g. Overgaard and Sandberg 2012)? In the papers of Fleming you refer to, metacognitive assessment always follows the behavioural response, which means it relies on processes such as e.g. error monitoring (see e.g. Young and Summerfield 2012), and in your paradigm the behavioural response is combined with the metacognitive rating, so it may be difficult to conceive it as a metacognitive measure of the confidence in choice ("Most notably, confidence in choice was used instead of visibility to determine metacognitive judgement.").

      Overgaard, M., & Sandberg, K. (2012). Kinds of access: different methods for report reveal different kinds of metacognitive access. Philosophical Transactions of the Royal Society B: Biological Sciences, 367(1594), 1287–1296. http://doi.org/10.1098/rstb...<br /> Yeung, N., & Summerfield, C. (2012). Metacognition in human decision-making: confidence and error monitoring. Phil. Trans. R. Soc. B, 367(1594), 1310–1321. http://doi.org/10.1098/rstb...

      1. "The AMT was defined as the lowest intensity that elicited at least 3 consecutive twitches, stimulated over the motor hot spot, while the participant was maintaining a voluntary contralateral finger-thumb contraction."

      There is no consistency in the literature in what is understood as AMT, the main differences are present in: the amount of pulses required, the amplitude of MEP required, the level of muscular contraction. By looking at this paper the reader cannot know what method was used, even if it was the same as Rounis 2010 it still says nothing, as she does not provide this information either.

      1. "cTBS was delivered with the handle pointing posteriorly and the coil placed tangentially to the scalp"

      What was the current direction used? If you did not change the current direction to the reversed (AP-PA in the brain), then the current flow (PA-AP) was the opposite to the optimal (AP-PA), that presumably resulted in higher motor thresholds compared to ones that are obtained by using the optimal method.

      1. "The standard cTBS pattern used, as with the Rounis 2010 study, was a burst of three pulses at 50 Hz given in 200 ms intervals, repeated for 300 pulses (or 100 bursts) for 20 s."

      It may be good to mention the pulses (if they) were biphasic. Also "given in 200 ms intervals" may confuse the reader, because she may not be sure whether the inter trial interval (the time period between the last pulse in the first train to the first pulse in the next train) was 160 ms (as it should be) or 200 ms.

      1. You have performed a lot of stimulations, have you forgotten that PPC was stimulated as well? There is no information in the paper on how PPC was determined; neither about the region of interest (within PPC) nor about the method used to target this region. Also, you may want to change PPN to PPC on the charts.

      2. Surprisingly, there are quite big differences in metacognitive sensitivity in the pre-TBS blocks of the experiment 1, which makes it impossible to compare the effects resulting from stimulation to the different sites. Even more surprisingly, you do not address this issue in the discussion.

      3. "In this way, we could rigorously explore the within subject likelihood of both a metacognitive impairment (or enhancement) following DLPFC cTBS and no metacognitive change following vertex cTBS, with a potential single subject replication of this pattern."

      Doesn’t the lack of counterbalancing across the simulation sites indicate this was not a "rigorous exploration" (e.g. an influence of the behavioural learning)?

      1. "The remaining 17 participants are summarised in table 5. Ten of these participants had no meta d’ changes on the first DLPFC session, and thus were not asked to return for subsequent sessions."

      Does it mean that if you got the intended effect (by rejection of >50% of the participants), you would conclude that cTBS influences metacognitive sensitivity? I assume that you would not, therefore it may be difficult to follow the idea behind the rejection of participants who do not confirm the expectations of the researchers.

      1. "Of the remaining 7 participants, 3 showed the expected impairment, while 4 showed a clear metacognitive enhancement following DLPFC cTBS. 6 of these 7 participants also showed a clear metacognitive change for the vertex control session, and thus were not asked to return for the 3rd session (2nd DLPFC)."

      Still quite difficult to follow. The possibility of obtaining some significant effects caused by stimulation to the control site, in my opinion, represents the goal of the active control stimulation (performed in order to evaluate whether the potential significant effect of stimulation is site-specific). Also it probably shouldn’t be surprising to observe some effects in your control condition, as the vertex stimulation may influence the activity in DMN (e.g. Jung 2016).

      Jung, J., Bungert, A., Bowtell, R., & Jackson, S. R. (2016). Vertex Stimulation as a Control Site for Transcranial Magnetic Stimulation: A Concurrent TMS/fMRI Study. Brain Stimulation, 9(1), 58–64. http://doi.org/10.1016/j.br...

      1. "We have therefore not only failed to replicate the Rounis result, but provided evidence from our own experiments that on this paradigm there is no modulatory effect of theta-burst TMS to DLPFC on metacognition."

      This evidence is not a scientific evidence, this explanation is as likely as the one that you did't apply the stimulation protocol properly (e.g. because it may work only when the current flow is perpendicular to the stimulated structure). The generalisations such as "no modulatory effect of theta-burst TMS" may not be accurate, especially in the case when one uses only the short version of one type of TBS protocols (300 pulses of cTBS), or "DLPFC" – this is just the general term, that is related to multiple subregions, and the stimulation in your study was (probably) applied just to one of them.

      1. "First, it may well be that cTBS of cortex, at the medically safe stimulation thresholds commonly employed (80% of active motor threshold) is just not intense enough to induce a subtle cognitive effect, such as a reduction in metacognitive sensitivity."

      Is there any way to verify this explanation? For example, by providing the reader with the information about the average MSO, the current direction used, the method used to determine AMT?

      1. "To our knowledge, only one published paper to date, besides that of Rounis and colleagues, has demonstrated the general efficacy of DLPFC cTBS in modulating cognitive performance (38)."

      What about, e.g.: cTBS applied to the left DLPFC impairs MCST performance (Ko 2008); DLPFC stimulation changes subjective evaluation of percepts, i.e. metacogniton (Chiang 2014); cTBS over the left DLPFC decreases medium load working memory performance (Schicktanz 2015). Moreover, Rahnev 2016 reported that both: cTBS applied to right aPFC and cTBS applied to right DLPFC affected metacognition. Is there any reason to ignore the results that are not consistent with the view presented in the discussion?

      Ko, J. H., Monchi, O., Ptito, A., Bloomfield, P., Houle, S., & Strafella, A. P. (2008). Theta burst stimulation-induced inhibition of dorsolateral prefrontal cortex reveals hemispheric asymmetry in striatal dopamine release during a set-shifting task – a TMS–[11C]raclopride PET study. European Journal of Neuroscience, 28(10), 2147–2155. http://doi.org/10.1111/j.146<br /> Schicktanz, N., Fastenrath, M., Milnik, A., Spalek, K., Auschra, B., Nyffeler, T., … Schwegler, K. (2015). Continuous Theta Burst Stimulation over the Left Dorsolateral Prefrontal Cortex Decreases Medium Load Working Memory Performance in Healthy Humans. PLoS ONE, 10(3). http://doi.org/10.1371/jour...<br /> Chiang, T.-C., Lu, R.-B., Hsieh, S., Chang, Y.-H., & Yang, Y.-K. (2014). Stimulation in the Dorsolateral Prefrontal Cortex Changes Subjective Evaluation of Percepts. PLOS ONE, 9(9), e106943. http://doi.org/10.1371/jour...<br /> Rahnev, D., Nee, D. E., Riddle, J., Larson, A. S., & D’Esposito, M. (n.d.). Causal evidence for frontal cortex organization for perceptual decision making.

      1. "Following a 1 minute interval, this was repeated at a different site for a further 20s (or again on the vertex in the control condition), determined by which group the participant was assigned to. The five groups were: i) bilateral DLPFC, ii) bilateral PPC, iii) left DLPFC and PPC, iv) right DLPFC and PPC, and v) VERTEX (control)."

      Did you counterbalance the starting sites of the stimulation?

      1. "However, the fact that we did not observe metacognitive impairment reliably in any subject in experiment two speaks against interpreting our null results simply in terms of missing the DLPFC during cTBS."

      Does it? Following this way of reasoning one may conclude you missed the DLPFC in the first experiment, as you observed the effect just for some of the participants.

      1. "... our results nevertheless indicate that the cTBS approach is not sensitive enough to establish a causal link between DLPFC and metacognitive processes."

      Can it stem from the fact you used a short version of the protocol (300 pulses), and a probability the conventional cTBS (600 pulses) is excitatory in the first half and switches to inhibition only after the full length protocol (see e.g. Gamboa 2010), so application of 300 cTBS pulses may result either in no change or in small inhibitory/excitatory effects? Or, can it rather result from a possibility that the site within DLPFC you were targeting may have nothing to do with metacognitive processes?

      Gamboa, O. L., Antal, A., Moliadze, V., & Paulus, W. (2010). Simply longer is not better: reversal of theta burst after-effect with prolonged stimulation. Experimental Brain Research, 204(2), 181–187. http://doi.org/10.1007/s002...

    1. On 2024-11-30 22:24:18, user xPeerd wrote:

      Peer review report from http://xpeerd.com

      Summary<br /> The preprint presents a novel strategy termed Transient Overexpression of P-glycoprotein (P-gp) for Cardiac reprogramming (TopCare) aimed at mitigating doxorubicin (Dox)-induced cardiotoxicity in cancer chemotherapy. The approach employs lipid nanoparticles (LNPs)-based mRNA therapeutics to transiently overexpress P-gp in cardiomyocytes, reducing intracellular Dox levels and associated cytotoxic effects, both in vitro and in vivo. The study demonstrates promising results, including enhanced survival rates and improved cardiac function in treated mice and pigs. However, detailed analysis and validation in clinical settings are needed.

      Major Revisions<br /> 1. Ethics and Concerns on mRNA Technology:<br /> The preprint does not provide comprehensive information on the long-term safety and potential mutagenic effects of repeated mRNA administration. Although the authors claim no potential insertion mutagenesis, a detailed toxicological assessment must be included.<br /> - Example: The long-term impact on genomic stability has been vaguely mentioned (Section: Results, Page 6) but needs further elaboration.

      1. Effectiveness on Large Animal Models:<br /> While the study highlights the preliminary success in pigs, it lacks comprehensive physiological data, myocardial histopathology, and the functional impact across different heart failure stages.
      2. Example: The pig model data is summarized, but detailed statistical analysis and larger sample size validation are crucial (Discussion, Page 7).

      3. Broader Relevance and Risk Mitigation:<br /> The potential immunogenicity of LNPs and mRNA therapeutics should be discussed to address the broader clinical relevance and possible adverse immune responses.

      4. Example: Immune response considerations are barely discussed (Page 10), which is critical for clinical translation.

      Recommendations<br /> 1. Enhance Toxicology and Safety Data:<br /> Include detailed data on the longitudinal impact of mRNA administration, focusing on potential genomic stability issues and systemic safety profiles. Consider supplementary studies evaluating mutagenic and oncogenic risks.<br /> 2. Comprehensive Animal Model Studies:<br /> Expand the large animal model studies to include a broader sample size and various cardiovascular conditions, supplemented with detailed histopathological analyses.<br /> 3. Immune Response Mitigation:<br /> Address potential immunogenicity by conducting comprehensive immunological assessments on treated animals and documenting any adverse reactions. Present a risk mitigation strategy for the clinical setting.<br /> 4. Expanded Clinical Relevance Exploration:<br /> Provide a more robust discussion on how to adapt the TopCare strategy to different cancer treatments, varying dosages, and combined therapies to ensure broader applicability.

      Minor Revisions<br /> 1. Textual and Formatting Errors:<br /> - Correct minor typographical errors and ensure consistent formatting across sections. Specific errors to address:<br /> - Page 2, Title capitalization inconsistency ("Cardiac Reprogramm...").<br /> - Figure labels and axis titles should follow uniform font size and style (Section: Results).<br /> 2. AI Content Analysis:<br /> - Estimated AI Content: Approximately 10-15%.<br /> - Highlighted AI-Detected Sections: Repetitive and templated language indicating likely AI aid in introduction and discussion.<br /> - Epistemic Impact Assessment: The AI-generated segments maintain consistency but could benefit from nuanced, domain-specific language refinements to underline originality and expertise..

      Overall, the preprint provides an innovative and promising approach to tackling cardiotoxicity in chemotherapy but requires crucial improvements and detailed validations before realistic clinical applications.

    1. On 2015-02-06 00:13:11, user Spiro Pantazatos wrote:

      Very nice study! I'm having trouble locating the supplement..under Data Supplements tab when I click on "Preview PDF" it shows the main text. Any ideas how to access the supplement? Thanks in advance, Spiro

    1. On 2017-09-06 01:22:27, user Jessica McFadyen wrote:

      We discussed this paper in our lab meeting and so I thought I'd share some of the comments in case they're helpful:

      * It might have been valuable to do scanning beforehand so that there were neural measures before people became experts at orientation discrimination.<br /> * In Figure 4, the responses for two and three steps look noisier, likely a result of smearing across subjects. Would be interesting to see the results of individuals, ideally showing the tuning functions for each person.<br /> - What would the results look like if, instead of categorising the EEG results into 0-125ms and 126-250ms time bins, it had been looked at continuously over time?<br /> * Q: Is this persuasive evidence of “lower-level sensory” processing vs. “higher-level” processing?<br /> - A: For the fMRI, might be more persuasive if the encoding results were just in the early visual cortex (but then perhaps this is reverse inference)<br /> - A: The EEG and fMRI experiments each show that the effect is early temporally and hierarchically, which is persuasive when taken together.<br /> - A: Maybe the question isn’t whether it’s “lower” or “higher” level processing, but rather that it’s both and how does this depend on exposure (training) and what the task is?

      Thanks for sharing this work on bioRxiv! Looking forward to seeing it published, very interesting work.

    1. On 2017-11-17 18:56:02, user Robin Rohwer wrote:

      Here are my responses to Pat Schloss's thoughtful review:

      1. You are correct: "blastn is only used to split the dataset and once split, the data are classified using the Wang method." We avoid classifying with BLAST because it doesn't take into account the phylogenetic structure of the reference database, which is why the Wang classifier is preferred for classification. We use BLAST to split the dataset because the Wang classifier's algorithm can cause misclassifications if the database is really small and you try to classify a sequence with no similar references (what we called "forcing" in the manuscript). We agree this distinction should be added more clearly to the Fig. 1 description!

      2. We didn't delve into the creation of custom databases in this paper because we felt it was outside the scope- TaxAss is only a tool to use them, not to make them. To learn more about how the FreshTrain was created, we suggest reading the Newton et al. 2011 citation (ref 12). We also cite papers about creating other ecosystem-specific databases, some of which also have really detailed methods descriptions. See text starting on lines 105 and 295 to find these references.

      3. "I am also not clear why the authors did not want to pool FreshTrain with one of the comprehensive databases. A simple cat command would pool the two files producing a file that could then be used as a single reference." <br /> This was also my first thought when faced with trying to use the FreshTrain for classification! But, it wouldn't work to simply concatenate two databases because some reference sequences would end up duplicated (corresponding to the yellow bars in Figure 2). For example, in Freshwater the major bacteria acI has a detailed phylogeny in the FreshTrain that includes multiple clades and tribes. Reference sequences for acI also exist in Greengenes, however they're called ACK-M1 and don't have detailed genuses or species under them. If the FreshTrain and Greengenes were concatenated, the Wang classifier would find two equally good references with different names. Then (because it is a stochastic algorithm that bootstraps its classification many times) it would place the acI OTU 50% of the time into "acI" and 50% of the time into "ACK-M1." That would result in a bootstrap confidence of ~50% for each, and the OTU would be called "unclassified." We'll add this into the discussion section about Current FreshTrain Usage.

      "Also, a downside of the Greengenes database is that the core reference appears to be moth balled going forward while RDP and SILVA are still actively being developed." <br /> Exactly! This is why TaxAss is great- it gives you the flexibility to pair your existing custom database with the most current version of whichever comprehensive database you prefer. It would take a lot of effort to incorporate the FreshTrain's phylogenetic structure into SILVA, and then that would need to be repeated every time SILVA or the FreshTrain is updated. That type of ARB work is beyond the scope of many 16S analyses, so TaxAss is a way for everyone to use the most up-to-date version. In regard to Greengenes being "moth balled," we agree that it doesn't look like it will be updated going forward. But we used it for this paper because it is still pretty comprehensive and it includes classifications to the species level (SILVA only goes to genus), which allowed for a better comparison since we were placing a lot of emphasis on improved fine-level classifications.

      1. "One motivation that the authors state for the method is the issue of 'forcing'. I would call these 'false positives', but I get their point." <br /> I like this suggestion for vocabulary and it seems like forcing is confusing to a lot of people. I'm also considering just calling it misclassification.

      "The authors raise this issue numerous times. Yet I was unable to find a citation that quantifies forcing and the authors do not appear to measure the amount of forcing in their data. Perhaps this is what they were getting at in Figure 3? If that is the case, then I am a bit troubled because they are accepting the FreshTrain data as the ground truth, when it has not been validated yet."<br /> You're right that this is what we're trying to get at in Figure 3! (Specifically, the red bars of figure 3 over named organisms.) To clarify, the ground truth in figure 3 is TaxAss (FreshTrain + Greengenes), and the forcing is observed through a FreshTrain-only classification. I don't know a way to quantify the exact amount of forcing/false positives because it is impossible to know the "truth" and it would be different with different datasets and different databases. However, we can see with some sequences that it is happening to an extent that it would negatively impact our interpretations, so I would argue that is evidence enough that it's a problem.

      How we know the forcing/false positive problem is real: We know that the FreshTrain database is limited in scope and does not contain all organisms in a dataset. And some organisms it doesn't contain have good references in Greengenes so we know what they are. So when we classify organisms we know are not contained in the FreshTrain using the FreshTrain, and we see some of them end up with a high-confidence FreshTrain classification, we know it's a problem! We can't say for sure exactly *how big* a problem it is, but we look at its practical impact on the datasets we tested. In Fig. 3 and Supp Fig. 3 we define organisms not included in the FreshTrain as those below the BLAST percent identity cutoff. When those are classified in the FreshTrain as part of a FreshTrain-only classification we see that most of these end up "unclassified", but that some end up with classifications that we know to be incorrect "forcing." The misclassified sequences seem like a small problem at the phylum level, but at finer taxonomic levels we see that they will negatively impact our analysis. Just based on the rank abundance curves, you can see that incorrect sequences are being lumped in with the major lineages adding error to our analyses. We are not the first to notice this problem, Woodhouse et al. (Ref. #23) also observed cyanos being forced/misclassified when trying to use the FreshTrain pre-TaxAss.

      "I could also imagine that even with FreshTrain, there might be forcing if a taxonomic name is set for the full length sequence, but two variable region sequences are identical even though their parent sequences have different taxonomies." <br /> Actually, that scenario wouldn't cause forcing it would cause false negatives/underclassification. This scenario would effectively be like having duplicate reference sequences as in your comment #3, where Wang does 50/50 and ends unclassified.

      "More importantly, the source code indicates that the authors are using any confidence score with out applying a filter. The suggested confidence score is 80%, not 0%. ... In offline conversations with the authors, they reassured me that they are applying an 80% threshold in separate scripts. It would probably be worth adding that they are using 80% as a threshold in the Methods section." <br /> We mention the bootstrap cutoff in passing in line 585, but I agree that perhaps it would be clearer if we add a bit more detail to the "How to use TaxAss" section. We left a lot of these details out because they're included in the step-by-step directions on the github website ( https://htmlpreview.github.... ) but it sounds like we should add another paragraph to the methods summarizing these directions.

      1. "Related to this point, at L122 the authors state that 'In a large database an OTU dissimilar to any reference sequences will not be classified repeatably as any one taxon, resulting in a low bootstrap confidence.' This is correct, but is a bit misleading. I would suggest saying '...repeatedly as any one genus, resulting in a low bootstrap confidence and reclassification at a higher taxonomic level where there is sufficient bootstrap confidence'." <br /> I'm not sure I understand your point, but I think it's that most bacteria are classified to the phylum level at least by Greengenes so it's misleading to say they are unclassified. However, many phyla should be unclassified at the phylum level in the FreshTrain database because their references don't exist at all, so I was trying to say hypothetically if that happened in Greengenes (the phylum ref. of an OTU not included b/c it's super weird and unknown) the Wang classifier would still work and call it unclassified, but that forcing is an issue when the database is smaller. I'm not sure how to make that more clear- suggestions welcome!

      "I am concerned that the results and the discussion of forcing are based on not using a confidence threshold rather than the default 80% threshold."<br /> Pat's so worried because we applied the cutoff in an R script, not it the mothur call. But don't worry! The 80% bootstrap confidence threshold was applied prior to all the analyses, just not in the mothur command. This way we were able to change it easily without re-running the classify.seqs command, which was helpful to compare the bootstrap cutoff's impact during development. Details:

      • The R script that applies the bootstrap cutoff is find_classification_disagreements.R . The easiest way to see when it's called is using the step-by-step directions: <br /> https://htmlpreview.github.... .

      • It's first used in step 13 to define what counts as a "conflict" among coarse-level assignments (i.e. things where both gg and fw were above the bootstrap cutoff and were given different names. Since the FreshTrain doesn't differ from Greengenes above family-level, we consider these "forcing" and trust GG more.).

      • In step 13, an intermediate file of bootstrap values is also exported, which is used to apply the bootstrap cutoff in step 14 plot_classification_disagreements.R when it compares the percent reads classified. Step 14 is where Fig 4 is created.

      • The bootstrap cutoff is again applied in step 15 when the final taxonomy file is created (also within find_classification_disagreements.R)

      • Step 15.5.a is where Fig 2 is created, and it's script plot_classification_improvement.R applies the bootstrap cutoff by incorporating an intermediate file of final.taxonomy.pvalues that is created in step 15.

      • Step 15.5.b is where Fig 3 is created, and it also uses the previously used scripts find_classification_disagreements.R and plot_classification_disagreements.R to apply the bootstrap cutoff.

      • The function that implements the cutoff within find_classification_disagreements.R is called do.bootstrap.cutoff(), and is defined on line 301 of the script.

      • "To measure forcing, I would like to see the authors run the Greengenes and FreshTrain databases back through the classifier using a leave-one-out testing procedure and quantify how many times the incorrect classification is given, when using the 80% (or even the 0%) threshold. Again, I suspect the results would indicate that the problem isn't one of forcing, but of "holding back". ..."<br /> We do see "holding back" as a major problem with using the FreshTrain alone- most sequences not in the FreshTrain database ended up unclassified. However, if that were the only problem you could just do a sequential classification instead of TaxAss- i.e. classify everything with the FreshTrain, then take all the unclassifieds and classify them with Greengenes. That's why we stress forcing so much- it's why TaxAss is necessary.

      "It would be a really helpful contribution to show the percentage of forcing (false positives) and holding back (false negatives?) in a leave-one-out scheme and on a real dataset when classifying with (1) each of the comprehensive databases, (2) using TaxAss with the comprehensive databases and FreshTrain, (3) merging the comprehensive databases with FreshTrain and running them through the Wang classifier."<br /> Leave-one-out schemes are often used to test classification algorithms, but I'm not convinced they would actually add that much to our understanding here. That's because the quantitative amount of forcing would be different with different datasets and databases, so very careful quantification of one example wouldn't apply very well to other work. I think knowing qualitatively it's a problem at a level impacting analysis is reason enough, which we could see clearly in Fig. 3.

      1. "I am not sure what the authors mean by "maintaining richness" as they use it in the manuscript. Could the problem they are trying to address be described better? Also, I would ask whether they know what the *true* richness is and if not, why they think that one value of richness is better than another. Perhaps this corresponds to what I might call "underclassifciation" or "false negatives".<br /> Yes, when we talk about maintaining richness we mean avoiding the underclassification (false negatives) of sequences not in the FreshTrain. We don't know the total "true" richness because that's impossible to know without a perfect *true* taxonomy database. But we know that when organisms with known references in Greengenes end up unclassified in a FreshTrain-only classification that that is an incorrect loss of richness. TaxAss avoids this by classifying those sequences in Greengenes and keeping their known classifications.

      It seems like Figure 3 was not explained well because the two confusing ideas here are: <br /> 1. forcing/misclassifications/false positives (red bars in Fig 3) and <br /> 2. lost richness/underclassification/false negatives (blue bars and red "unclassified" bars in Fig 3). <br /> I welcome any more ideas on how to explain this better!

      L25 - "why not include the RDP reference database in this list?" <br /> I did include RDP in the intro on line 103, but I didn't include in the abstract b/c I was trying to be more concise and I didn't realize it was still actually being used. I thought it was much smaller than both SILVA and Greengenes now?

      L49 - "Course" should be "Coarse"<br /> ahhh I'm so embarrassed!!

      Thanks again to Pat Schloss for sharing his thoughts and starting this discussion! I encourage other readers and users of TaxAss to weigh in with their thoughts, critiques, and questions too.

    1. On 2020-11-14 02:58:55, user Radostin Danev wrote:

      Very exciting work!<br /> I would recommend replacing "Near-atomic resolution" with "Cryo-EM" in the title. Also, replace "unbiased" with "reference-free" in "Unbiased cryo-EM image processing" in the methods.

      Best wishes,

      Rado

    1. On 2024-07-04 16:16:55, user Michael F Miles wrote:

      This article is now published in Neuropsychopharmacology. There is a change in the order of the first 2 authors and the first name of Jeremy Nguyen (Angel Nguyen) in the final published version.

      Mignogna KM, Tatom Z, Macleod L, Sergi Z, Nguyen A, Michenkova M, Smith ML, Miles MF. Identification of novel genetic loci and candidate genes for progressive ethanol consumption in diversity outbred mice. Neuropsychopharmacology. 2024 Jun 29. doi: 10.1038/s41386-024-01902-6. Epub ahead of print. PMID: 38951586.

    1. On 2019-02-07 20:46:49, user Jen Quick-Cleveland wrote:

      This is beautiful, methodical work. This is going to be seminal. Im very interested in using flow with yeast. May I please have the plasmids for ymNeonGreen and ymScarlet? Let me know and I will send you my Fedex info. Congratulations on this work!!!

    1. On 2025-07-03 00:51:23, user GUY GILRON wrote:

      Critical Review: “Fish remain high in selenium long after mountaintop coal mines close” (Cooke et al, 2025)1

      Guy Gilron, Borealis Environmental Consulting Inc., North Vancouver, BC CANADA

      This above article presents new selenium (Se) data in muscle tissue from three fish species in Crowsnest Lake (i.e., brown trout, lake trout, and mountain whitefish) and concludes that these data represent an environmental concern, based on the fact that the tissue Se concentrations exceed fish tissue guidelines. However, the article’s interpretation, contextual framing, and supporting evidence for these claims raise several scientific and methodological concerns.<br /> The authors posit an apparent paradox, specifically, that low aqueous Se concentrations and elevated fish muscle Se concentrations. This is presented as an alarming ecological signal, and supports the thesis that the Se in these fish has accumulated over many years despite low aqueous concentrations. The assumption here is that Se has potentially cycled within the food web; however, a more fulsome historical understanding of this system is required to make this link. Specifically, were aqueous Se concentrations historically higher, and then declined more recently? If this were the case, comparing current water Se concentrations to current fish tissue concentrations is an “apples vs oranges” scenario. While elevated tissue Se in fish certainly warrants further investigation (i.e., are populations and/or fish health being impacted?), this ‘paradox’ is actually not inherently unusual. Selenium bioaccumulates, particularly in food webs involving algae, invertebrates and fish/birds, and tissue concentrations can remain elevated for years after aqueous exposures have declined, particularly in lentic waters with longer residence times. Without time-resolved aqueous and tissue Se data, it is at best speculative to interpret these findings as alarming, or even ecologically significant. The article does not present any data or evidence of historical Se concentrations in water or biota to support its claims of historical or ongoing accumulation.<br /> The article presents new Se fish tissue data, but fails to reference any previous monitoring efforts in Crowsnest Lake or nearby waterbodies. Consequently, one cannot assess trends in Se (i.e., whether concentrations are increasing, stable, or anomalous). This is significant, since it would need to be demonstrated that high concentrations had been sustained in order for Se to bioaccumulate in aquatic biota tissues. Moreover, there is no attempt to address the mobility patterns of the fish species sampled, which is a significant omission, given the authors’ assertion that the Se in the system originated from the two decommissioned mines2. For example, species like brown trout and mountain whitefish may use tributaries for spawning or feeding, potentially exposing them to elevated Se concentrations outside the lake. If this is the case, then the lake itself may not have been the primary source of Se accumulation. Without tools like radiotelemetry, tagging, or isotopic forensics, the source attribution to Crowsnest Lake or Tent Mountain is speculative.<br /> The authors themselves acknowledge that the fish populations reported on in the paper (i.e., brown trout, lake trout, and mountain whitefish) in Crowsnest Lake are “self-sustaining”; they then suggest that current tissue Se concentrations may lead to a “population collapse” or “reproductive failure”. This contradiction is neither reconciled nor supported with data on recruitment, deformities, or reproductive metrics. The reference to such a collapse is not only unsupported, but actually conflicts with their own admission of population persistence. The article further suggests that Whirling Disease and Se toxicity could have overlapping symptoms, possibly confounding diagnoses. This suggestion is completely speculative and unsubstantiated. No peer-reviewed evidence to-date links Se-induced pathologies in fish to the clinical signs of Myxobolus cerebralis infection (the cause of Whirling Disease). <br /> A central assumption of the paper is that Se is leaching into the lake from historical waste rock from the closed Tent Mountain mine. However, the authors provide no chemical fingerprinting, hydrological modeling, or sediment Se profiles to demonstrate a link. As such, the attribution again remains speculative and circumstantial. Phrases such as “devastating consequences,” “complete reproductive failure,” and “acute threat” are used throughout the paper without any corresponding ecological data. These statements are alarmist and do not reflect the chronic, sub-lethal, nature of Se toxicity in aquatic ecosystems; it is well known that Se is not acutely toxic at environmental concentrations and does not cause sudden population collapses in the absence of sustained exposure and bioaccumulation.<br /> Figure 2 compares Se concentrations across fish species and regions, but does not control for species-specific bioaccumulation potential, life stage, or habitat use. Comparing lake trout to other fish in other regions is both inappropriate and misleading. Species-specific comparisons are more relevant, and a consideration of whether the fish inhabit lentic vs lotic systems would make the comparison more valid and informative. Furthermore, no effort is made to explain the geological and ecological differences among the geographically-diverse reference sites in comparison to Crowsnest Lake.<br /> While the authors report Se concentrations in fish tissue, key details on analytical methods, quality control, and lab accreditation are not provided in the article. Without such information, confidence in the analytical results is difficult to evaluate fully. This is especially important in the case of Se, due to its low environmental concentrations and the complexity of accurately measuring low concentrations. As suggested, and given the significant implications of these data, independent verification or confirmation through expert review is highly recommended.<br /> It should be noted that the article comprises a couple of important inaccuracies, specifically:<br /> • the article refers to a CCME sediment Se guideline of 2 µg/g, which does not exist; Canada has not adopted sediment guidelines for Se. Additionally, the cited whole-body fish tissue guideline of 6.7 µg/g appears to be based on the ECCC Federal Environmental Quality Guideline (FEQG), and is not a CCME guideline. The FEQG applies specifically to egg/ovary Se (14.7 µg/g) and muscle Se only as a screening value. Mis-stating the origin and intent of these values is a significant error that undermines the scientific rigor of the article; and,<br /> • the article cites the 93% decline in Westslope Cutthroat Trout in the Fording River, but fail to cite the detailed, peer-reviewed Investigation of Cause (IOC) study, which attributed the decline to climatic conditions and not selenium toxicity. <br /> • the article incorrectly implies that a $60 million fine was due to this decline. That fine, in fact, stemmed from broader non-compliance issues from 2012 – long before that decline occurred - and not a direct attribution to the population drop.

      Summary<br /> While it is understandable that elevated Se in fish tissue relative to low water concentrations raises a concern, the information provided in this paper fails to establish causality, provide historical or trophic context, or rigorously support its conclusions. The speculative connections to Tent Mountain, Whirling Disease, and catastrophic ecological effects are not supported by specific and relevant evidence. Misuse of terminology, misattribution of guideline values, and emotionally-charged language further erodes its credibility.<br /> A study of this type initially requires the clear identification and articulation of key research hypotheses (e.g., “is the elevated Se in fish tissue mine-related?”; “how is Se cycled in Crowsnest Lake”), and then determine what data/information are required to address those hypotheses. A multi-disciplinary, scientifically-defensible approach integrating fish movement, food web monitoring, sediment and water Se speciation, and reproductive success metrics, is essential to developing and reporting on scientifically-defensible conclusions.

    1. On 2021-09-20 11:28:54, user Aalok Varma wrote:

      This preprint was presented at our lab journal club and we thought we’d start an open discussion about these results.

      We would first like to note that it was a pleasure to discuss the results in this paper, which we found rather interesting, and we had a very fruitful discussion. Nevertheless, we had several questions and clarifications that we were hoping you would be able to help resolve:

      1. Could you please describe a bit more in detail how exactly bouts are defined and how bursts and bouts are distinguished from one another in the processed VNR signal? Is there an interbout interval threshold set to separate bouts, for instance? If yes, what was the value used?

      2. Proof of the idea of measuring conduction velocities using voltage imaging is neat. However, is there some validation of the conduction velocities, as measured by the sub-Nyquist interpolated spike timing (SNAPT) method? For instance, can you compare measurements of conduction velocity by this method with, say, measurements from dual recordings with downstream partners to compare the delay between activation of a cell and the arrival of a PSC? It is not perfect, of course, but given that actually recording from dendrites etc is so challenging in small preps like larval zebrafish, it would be a useful reference value for comparison of how accurate the SNAPT measurements are.

      3. The analysis of Figure 4 involves sorting bouts as those having >50% of active V3. This is a rather arbitrary classification, especially since there aren’t too many neurons per field of view so the difference between 40% and 60% might be just one neuron or so. Why not go the other way around, and first classify bouts as strong/weak and then ask what fraction of V3s was active, across all trials, by plotting bout strength against % of V3 active as a scatter plot? Moreover, we have some concerns with the definition of bout strength. Taking the average cumulative value as the bout strength doesn’t really capture the true bout strength, in our view, since it only captures amplitude, and not so much duration. In Fig 4A (bottom), for instance, bout #2 looks much weaker than bout #7 (which is longer). Yet, their computed “bout strength” is very similar. Why not use Area Under the Curve as a proxy for bout strength? It would capture both amplitude and duration in the definition of “strength”. This analysis may not change the results or the overall story, but is a more objective way of analysing the data, we think.

      4. From the representative plots shown in Fig 5C and D, it seems that when V3 neurons’ activation is turned off, the bout ends. Yet, from the earlier figures, it seems that V3 activity is sustained even after a bout ends. Is it possible with the resources available to perform acute inhibition of these neurons during a bout, to test if shutting their activity suppresses swims? It would lend support to the hypothesis that V3 activity sustains bouts?

      5. The switch to free swimming with optomotor response for the experiment in Fig 6 wasn’t very clear. Moreover, we don’t agree with the interpretation of the result about bout speed modulation in Fig 6C. From the raw data points, the distributions seem largely overlapping, and the difference being detected may simply be because of the large difference in the sample sizes between the control and the ablated groups. Also, how about doing the ablation experiment using the same paradigm as in Fig 5? That way, results may be easier to compare. Furthermore, it is interesting that there is no difference in bout durations in vivo with V3 ablation, although all previous experiments suggest that one should expect a reduction in bout duration on V3 ablation. This may be because of functional compensation/adaptation because of a genetic ablation of V3 neurons from birth. Hence, it may be better to perform acute inhibition in the V3 population during free-swimming OMR, provided you have lines to do the same.

      Other general comments:<br /> 1. Could the legends please include all n’s, as appropriate? Some legends have it, others don’t. It would make the reading much easier.<br /> 2. Fig 1G and Supplementary Fig 3 - clarify the dorsoventral axis schematic. What does 0-1 mean - as in, which is ventral and which dorsal? I think 1 would be ventral, given that active motor interneurons seem to be positioned that way, but a clarification is needed and would make the figure easier to interpret.<br /> 3. Could you please describe the filters being used in a bit more detail, instead of simply stating “high-pass filtered”? What filter type was used (Butterworth, etc.)? What were the cutoff frequencies (sometimes time constants are mentioned, but it would be better to be consistent in the reporting of these details)?<br /> 4. In the introduction, it is stated that “adapting motor output can also happen via changes in tail amplitude or force, without substantial changes in frequency.” Recent work from our lab - Jha and Thirumalai (Current Biology, 2020) - has supported this claim, and we have also shown using whole-cell recordings that this can be explained by changes in the intrinsic properties and recruitment of primary motor neurons at lower speeds. We hope you go through our paper and find it useful, in which case a citation of our work would be much appreciated.

      We hope you find some of our comments useful, and we eagerly look forward to hearing back from you.

      Thanks in advance.<br /> Best,<br /> Aalok Varma<br /> Neural Circuits and Development Lab<br /> National Centre for Biological Sciences (NCBS),<br /> India

    1. On 2019-01-24 20:20:15, user friend wrote:

      I would like to inform authors that the gold standard reference gene trees available on SwissTree's FTP have many identifiers that do not correspond to the FASTA sequences provided (selected case: HoxA9_XENTR_ENSXETG00000000724 in ST006). The FTP could use a README file explaining the content of the files - are gold standard trees stored in the swisstree.nhx file or in consensus.nhx file within directories (ST001-ST012)? Also, the gene trees ST003-4, ST006-12 are not displaying at all on the SwissTree website.

    1. On 2024-04-25 23:14:15, user Michelle Wille wrote:

      This is an important study rapidly presenting key findings of sampling for HPAI in the Antarctic region. We have some concerns around the interpretation of the results - we beleive the diagnostic used is excellent at detecting a broad diversity of H5 viruses and is not specific to HPAI H5 and therefore it is unclear whether the authors detected HPAI H5N1 or LPAI H5Nx. A summary of our concerns has been presented here: https://www.preprints.org/m...

    1. On 2022-04-02 19:30:00, user Daniel Baldauf wrote:

      Hi Lisa, that's an interesting study, congrats! When reading it I wondered how much of the effects increased gamma has on memory performance might be mediated by attentional processes. By the way, when you describe the relationship between gamma oscillations and increased attention and/or neuronal information processing, you may also want to relate also to studies of cross-areal gamma coherence, for example between frontal cortex and visual areas (e.g., Baldauf & Desimone, 2014, Sci.). To some extend such cross-areal gamma coupling is even more relevant for efficient neuronal information processing under attention, no?

    1. On 2020-10-03 06:47:27, user Holger Gerhardt wrote:

      Super cool stuff Claudio! I believe this is a very important discovery that will hopefully pave the way towards selective interference for example in situations where excessive and unwanted vascular sprouting threatens tissue functions. Maybe in ocular conditions. The question is whether targeting such fundamental cell biological nodes that are present in essentially all cell types will ever become manageable in a therapeutic setting. Nonetheless, your work provides very important insights into the biology of angiogenic invasion. Congratulations! Cheers, Holger